Skip to main content

Table 2 Candidate reference genes, TgCAD target gene, specific qRT-PCR primers and different parameters derived from qRT-PCR analysis

From: Identification and validation of quantitative real-time reverse transcription PCR reference genes for gene expression analysis in teak (Tectona grandis L.f.)

Gene symbol Accession number Primer sequences (5′-3′) forward/reverse Tm (°C) Amplicon length (bp) Primer efficiency R2
Tgrp60s JZ515972 AGAAGCAGGCGAAGAAATCA/GTGGGCATGATGTGGTTGTA 75.9 70 91.4 0.998
TgCac JZ515973 ATCTTGTGGAAGAAATGGATGC/TTCGCAAACAACAGAGTGAGAT 77.4 127 91.7 0.994
TgAct JZ515974 TCCAGAAGAGCACCCAATTC/CAGGGGCATTAAAGGTCTCA 77.9 100 91.6 0.995
TgHis3 JZ515975 TGGCTTTGGAACCTCAAATC/CCCTGGAACTGTTGCTCTTC 81.2 135 92.4 0.998
TgSand JZ515976 GCCCAAAAAGCATCTCTTCA/TTGTGGTGAGCAAGATCAGG 77.1 187 108.5 0.987
TgΒ-Tub JZ515977 CAAGATGAGCACGAAAGAAGTG/CGGAACATCTCCTGTATCGAC 81.1 180 93.8 0.982
TgUbq JZ515978 CGGGTAAGACCATAACTCTGGA/GTCGATTCCTTTTGGATGTTGT 85.6 171 92.8 0.998
TgEf-1α JZ515979 ACCACACCAAAATACTCCAAGG/TGGACCTCTCAATCATGTTGTC 78.1 145 93.5 0.999
TgGAPDH FN431983.1 GGCCACCTATGAGGAGATCA/CCAAGATGCCCTTTAGCTTG 79.2 152 101.9 0.998
TgCAD JZ515980 CGGCAAGGTCTACAAAGGAG/GGCTGTTTATCGCTTGCTTC 78.8 200 98.4 0.993