Skip to main content

Table 2 Primers used in this work

From: Validation of reference genes for quantitative real-time PCR (qPCR) analysis of Actinobacillus suis

Primer name Sequence Source
ASU2-16SrRNA-F1 GTGTAGCGGTGAAATGCGTAGAG This work
ASU2-16SrRNA-R1 ACATGAGCGTCAGTACATTCCCA This work
ASU2-ackA-F1 AGCCACCTATTCATCACATCACAA This work
ASU2-ackA-R1 TACGAACAACAGATACAGAACCACC This work
ASU2-glyA-F1 GTTTATATCCGAATCCATTACCGCAC This work
ASU2-glyA-R1 TCATCGCCACAAGCAGAAAGAA This work
ASU2-gyrA-F1 ATCTGGTATTGCGGTTGGTATGG This work
ASU2-gyrA-R1 TTCTTCAATGCTGATTTGCTCGTTT This work
ASU2-proS-F1 GTGGACAAAGCGTCATTACAAGAAAC This work
ASU2-proS-R1 CGGAAATCTAAACCAAGACGAGTGAA This work
ASU2-pyk-F1 CAACTGAAGAAGCAATGGACGACA This work
ASU2-pyk-R1 AACTAACGCAGCATCACCGATTT This work
ASU2-rho-F1 TTCTTCCTGACGGTTTCGGTTTCTT This work
ASU2-rho-R1 AACGGCGGATTTGGCTTGGT This work
ASU2-rpoB-F1 AAACGCAACAAGATCATTCAAGGTG This work
ASU2-rpoB-R1 ATTTGACGACGAACCGCTAAGTAAA This work