Skip to main content

Table 2 Primer sequence, location and expected amplicon sizes for dog COX-1 ( PTGS1 ), COX-2 ( PTGS2 ) and HPRT1 genes

From: Cyclooxygenase 1 mRNA expression is undetectable in Madin Darby Canine Kidney cells

Gene Accession Primer name Primer sequence Amplicon (bp) Location
PTGS1 NM_001003023 Cox1_E10-11 F TGTCCTTCCAGGAACTCACA 161 Exon10
Cox1_E10-11R GAAGGGAGCCCCAATTTCTA Exon11
PTGS1 NM_001003023 Cox1_E8-9 F ATCCTCATTGGGGAGACCAT 193 Exon8-9
Cox1_E8-9R AACCCACCCAGAAGGAGTCT Exon9
PTGS1 NM_001003023 Cox1_E4-5 F CTTTCCTCCACTTCCTGCTG 168 Exon4
Cox1_E4-5R AGAAGGACTCCCAGCTGATG Exon5
PTGS2 NM_001003354 Cox2_E6-7 F GTTCATTCCTGATCCCCAAG 186 Exon6
Cox2_E6-7R TTGAAAAGGCGCAGTTTATG Exon7
HPRT1 NM_001003357 Hprt1_F TGACACTGGGAAAACAATGCAGACT 110 Exon6
Hprt1_R AGCCAACACTTCGAGGGGTCCT Exon7