Skip to main content

Table 1 Characterization and levels of variability at 24 microsatellite loci of Tetranychus urticae

From: Isolation, characterization and PCR multiplexing of microsatellite loci for a mite crop pest, Tetranychus urticae (Acari: Tetranychidae)

Locus Motif Primer sequence (5′–3′) Scaffold number Number of set Dye GenBank accession No Size range Na Ho He
TuLS14 (ATG)7 F: GCAAATGAAGCTTACCAATTA 17 2 VIC KJ545959 191–210 7 0.2 0.60
R: TAAAGGTTTGGCAGTTCAGT
TuLS16 (CAT)10 F: AATTGCTTATCACCCACATC 21 2 PET KJ545960 186–228 16 0.39 0.79
R: TTAGTTGCTTGTTGAGCAGA
TuLS17 (ATG)6 F: TCTTCGTTCGATAGCTTTTC 23 2 FAM KJ545961 192–207 6 0.03 0.55
R: TCCTCAGGTATATCAGGTGG
TuLS19 (TG)6 F CAAAAGTTGGACATTTCAGG 24 2 NED KJ545962 195–211 8 0.28 0.71
R: TCCTTCCACAGTCAATATCC
TuLS20 (TTG)6 F: AAGCTGGATTCATAGAAGCA 27 1 PET KJ545963 212–218 3 0.16 0.38
R: AAATTAATTCAGCCTCGTCA
TuLS22 (TG)6 F: GCAATCGTTTGTTTTCATTT 33 1 NED KJ545964 191–203 5 0.17 0.43
R: TCACAATTGATGATGCTTGT
TuLS23 (TAA)6 F: TGGTAACTGCATCAACCATA 34 3 PET KJ545965 193–202 4 0.21 0.66
R: AAGATTCGGGAAGATTAAGG
TuLS24 (GA)7 F: TGTTGTATGGGAATAAGACAAG 36 3 VIC KJ545966 225–238 10 0.26 0.69
R: GTGATTGGCCTGATAATGTT
TuLS35 (TG)8 F: GGAAACGTATCACAATTTGG 100 2 FAM KJ545967 204–292 8 0.17 0.70
R AGAATCTTTTGTTGCTTCCA
TuLS38 (CAA)6 F: CAACACCAATCACAAAATGA 15 1 NED KJ545968 239–253 5 0.03 0.13
R: GTTGGACTTGGTGAATCAGT
TuLS39 (AGC)6 F: ACATTATCGTTCGGTTCATC 17 3 VIC KJ545969 270–293 7 0.04 0.15
R: CTTTGTTCCCTTTTATGTGC
TuLS41 (CAT)6 F: GAATGAAGATTGGTGGGTTA 23 3 PET KJ545970 242–261 8 0.27 0.53
R: TCAAGATTTTGGAATCAGAGA
TuLS42 (ATC)5 F: TTCCTCTTCCTTGTCTTTCA 27 3 FAM KJ545971 230–269 10 0.07 0.52
R: CATCATCTTGTTGTTTGTGC
TuLS43 (GAT)5 F: AATGGAGGTATGGATGACG 28 3 NED KJ545972 262–277 4 0.02 0.14
R: AAAGCTGCTGAAAGTCACTC
Tupm07* (CT)10 F: CCAATCACTGTGTTGATCGC 13 3 NED na 79–94 10 0.43 0.71
R: GGCTGGTTTCTCTTTCTCCC
Tupm08* (AG)10 F AAGCAACAGTTTAGGATGAGAAGG 16 2 PET na 78–92 8 0.33 0.81
R: AGTCCATCTTCCTCTTGTCTTCTAGT
Tupm09* (CT)10 F: TGAAAAGCGAAACATTGATTCTA 6 3 FAM na 74–91 8 0.31 0.80
R: GAAATGTCGAGTTGTCAGGG
TuCA12* (CA)7 F: GATTTGTGGTCGTGGTTTTC 9 1 FAM AB263078 177–287 15 0.23 0.78
R: GATCAACTCAAAAGGATAACGTTG
TuCA83* (GT)6 F: CAGGGTGAAACTTAGATACC 2 1 VIC AB263081 201–219 11 0.24 0.74
R: CAATTTTCCCTCTACATCTC
TuCA96* (TG)7 F: ATGGATTGTCACCGATTTCA 11 1 PET AB263082 109–218 4 0.10 0.60
R: CTGAAGTTTACTTGCTATAGTC
TuCT09* (CT)15 F: GATCACTTTTTCATGTTATTCTG na 2 FAM AB263084 108–118 7 0.08 0.53
R: CTTGGAATGAACTTTAGCAC
TuCT67* (CT)9 F: CCATCATCTTCATCATTCTTCACC 9 2 NED AB263090 88–112 15 0.21 0.73
R: TAGAACAGTCAAGCAAAAAGAGTC
TuCT73* (CA)7 F: CGATGTGGGTGGTAAGCATG 18 1 VIC AB263091 106–214 9 0.25 0.69
R: ACGATGATATTGATGATGAGCG
Tu35b* (TGA)8 F: CTTCCCGAAGGCTGTTGATA 1 1 NED AJ419832 91–113 6 0.22 0.40
R: AATGGAATGAGTTATCGTTGGG
  1. The scaffold number is given as indicated in the annotated whole genome of T. urticae and can be retrieved at ORCAE [16].“Na” is the number of alleles. Observed heterozygosities (Ho) Expected heterozygosities (He) calculated with ADEgenet R package [17].
  2. * Loci published previously.