Skip to main content

Table 3 PCR primers, accession or contig numbers, amplicon sizes and PCR efficiencies

From: Effects of mining chemicals on fish: exposure to tailings containing Lilaflot D817M induces CYP1A transcription in Atlantic salmon smolt

Gene product Gene name Marker for Accession no. Forward primer Reverse primer Amplicon size (bp) PCR efficiency liver/gills
Catalase CAT Oxidative stress BT059457 CCCAAGTCTTCATCCAGAAACG CGTGGGCTCAGTGTTGTTGA 123 2.03
Glutathione peroxidase 1 GPX1 Oxidative stress DW566563 GCCCACCCCTTGTTTGTGTA AGACAGGGCTCCACATGATGA 103 1.96
Manganese superoxide dismutase MNSOD Oxidative stress DY718412 GTTTCTCTCCAGCCTGCTCTAAG CCGCTCTCCTTGTCGAAGC 227 1.87
Heme oxygenase 1 HMOX1 Iron metabolism/oxidative stress BG936101 AGCAGATTAAAGCTGTAACCAAGGA GCCAGCATCAGCTCAGTGTTC 64 2.07/1.75
Heat shock protein 70 HSP70 Protein folding/oxidative stress BG933934 CCCCTGTCCCTGGGTATTG CACCAGGCTGGTTGTCTGAGT 121 2.04/2.06
Metallothionein B MTB Stress/oxidative stress CK990996 TGAATAAAGAAGCGCGATCAAA CTGGTGCATGCGCAGTTG 111 1.87
Hypoxia-inducible factor 1A HIF1A Oxidative stress DY708816 CCACCTCATGAAGACCCATCA TCTCCACCCACACAAAGCCT 101 1.94
Cytochrome P450 1A CYP1A Detoxification AF364076 TGGAGATCTTCCGGCACTCT CAGGTGTCCTTGGGAATGGA 101 2.06/1.92
Cytochrome P450 3A CYP3A Detoxification DQ361036 ACTAGAGAGGGTCGCCAAGA TACTGAACCGCTCTGGTTTG 146 2.00
Glutathione S-transferase P1 GSTP1 Detoxification/oxidative stress BQ036247 ATTTTGGGACGGGCTGACA CCTGGTGCTCTGCTCCAGTT 81 2.11
Tumor suppressor p53 P53 DNA damage BT058777 CTCGCCAGACCTGAACAAGTT ATAGATGGCCAGGGCTCGTA 112 2.34
Apoptosis regulator Bcl-X BCLX DNA damage/apoptosis NM_001141086 GCCTGGACGCAGTGAAAGAG GGACGGCGTGATGTGTAGCT 107 1.99
Insulin-like growth factor binding protein 1B IGFBP1B Anti-growth AY662657 GAGGACCAGGGACAAGAGAAAGT GCACCCTCATTTTTGGTGTCA 101 1.98
Mitogen-activated kinase 1 MAPK1 MAP kinase activity EF101948 TCAATCTGGAGAAGGAGCTCGTA CTACCTGCCGTAGCTCTTCGAT 51 1.81
Caspase 3B CASP3B Apoptosis DQ008069 AGCCGATTCGGTGTTAAAAGG CCGGAGGCTTAGCGTCTACTT 107 2.08
Tumor necrosis factor receptor superfamily 1A TNFRSF1A Infammation/apoptosis NM_001141773 AAGACCTGCCTCCGTTGTACA CTGAGGCACTCCCGTGTTTC 140 1.96
B-actin ACTB Reference gene BG933897 CCAAAGCCAACAGGGAGAA AGGGACAACACTGCCTGGAT 92 1.94/1.85
Eukaryotic translation elongation factor 1 alpha B EEF1AB Reference gene BG933853 TGCCCCTCCAGGATGTCTAC CACGGCCCACAGGTACTG 59 2.00
Ribosomal protein L13 RPL13 Reference gene NM_001141291 CCAATGTACAGCGCCTGAAA CGTGGCCATCTTGAGTTCCT 110 2.02/2.05
60S ribosomal protein L40 UBA52 Reference gene GO054675 GATCTTCGCTGGCAAACAACT CGAAGACGCAGCACAAGATG 93 /2.12