Skip to main content

Advertisement

Table 2 Primers used for the amplification of hyaluronate lyase gene in S. suis strains

From: Hyaluronate lyase activity of Streptococcus suis serotype 2 and modulatory effects of hyaluronic acid on the bacterium’s virulence properties

Primer name Sequence (5′–3′)
HYLA5587F CCCGCATAAAAAGGAAAGGAAACAC
HYLA5614Fi ATGGGATTTTTTATCAGTCAAAGCA
HYLA5916R TTCTTTTGTCGCCTGAACAGCTTGC
HYLA6414 CGAATACGTAGAAAAGACACCAGAA
HYLA6414R TTCTGGTGTCTTTTCTACGTATTCG
HYLA6722R TCGTTAGATTGGTAGCGTTTATTGG
HYLA7213 AGACGGATTTGAGCAAGGTGGCCAT
HYLA7516R GTCATATCCATCAGTTCACCGCGAA
HYLA8014 TTACCGGGAACGACAACGACCAAGG
HYLA8315R TCTGTCACTACTTCTTTGGACAAAT
HYLA8792 CCGTAAAGAATGGCATTGAGTTGAC
HYLA9109Ri AGGAGTGCGATCTGCGACACTTGAA
HYLA9138R CGCTCCCCCTTCACCCACGAATTTC