Skip to main content

Table 2 Description of the 93 SSR markers developed for U. decumbens

From: Microsatellite loci for Urochloa decumbens (Stapf) R.D. Webster and cross-amplification in other Urochloa species

SSR locus GenBank accession number Primer sequences (5′–3′) Repeat motif Ta (°C)a Size (bp) NAb PICc DPd
Dec01 KT587691 F_CAAACGACTGCTGATGATGG (AC)16 65° 250–280 5 0.68 0.89
R_TGAGAGGCTAAGAG/CAACCTG
Dec03 KT587692 F_AACTGAACGCTGCTTGGTCT (GT)6 65° 240–260 3 0.58 0.63
R_GGTCCGGAATAAAAAGCACA
Dec05 KT587693 F_GGGCTCCTCATCAGCAGTAG (GAC)4 65° 132–140 4 0.61 0.54
R_GATGCCTCTCGGGACTATCA
Dec06 KT587694 F_GTTCATGGGGGCAATCAGT (CTGG)3 65° 120–130 4 0.70 0.54
R_CGTGATGTCTGAACGGATGA
Dec07 KT587695 F_CGAACACATTCACATACAACA (AC)7 65° 226–242 5 0.74 0.87
R_CTGTCGGATTTATTTGCATTA
Dec09 KT587696 F_GCCCAACTGGAATGTGCTA (TC)9 65° 240–280 5 0.72 0.91
R_CGACGTCCTTGTTGTTTGTC
Dec10 KT587697 F_GACGTCGAGGACAAACAACA (CAAG)3 65° 216–256 6 0.79 0.86
R_TCCTTACCCTTGCGATTCAC
Dec11 KT587698 F_GGGGGAAAATGAGACAGACA (AG)16 65° 154–198 8 0.80 0.94
R_GCTAACCAGACAGCCACCAC
Dec12 KT587699 F_CTCACACCCTCCTTCTGCTG (GT)9 65° 196–226 9 0.82 0.97
R_CGATCGCTCCCTACTAGTGC
Dec13 KT587700 F_CCCCCGTAAAACAGACAAAA (TA)6 65° 166–178 5 0.72 0.89
R_ACCATGATACAACGCTGCAA
Dec14 KT587701 F_AAACGGAGAAAGGGGATCAT (GAC)4 65° 290–310 3 0.62 0.22
R_GAGCATACATGCAGCAGTGG
Dec17 KT587702 F_CCTTCGTCCATTACCCTGAA (TG)9 65° 224–248 6 0.63 0.72
R_ATCCACCAGTGCACGTATGA
Dec18 KT587703 F_ACGCACACACACGAACAAAT (CGAT)3 65° 180–202 6 0.78 0.96
R_ATTTCGACATGCCTGCAACT
Dec19 KT587704 F_AGGTTCGATAATCGGCACAC (GT)7 65° 220–236 6 0.79 0.95
R_CGCAAGTGGTCAAGCAATTA
Dec20 KT587705 F_ACCTTGAACTCCTGCTTTTGT (AC)10 65° 150–168 6 0.75 0.92
R_AGCACTATCACCAATCAGCAA
Dec21 KT587706 F_GCCGACATCAACTTCCATTT (GT)7 65° 176–190 5 0.76 0.85
R_CTCCTTGGTCCAATTCCTCA
Dec22 KT587707 F_GTGTGTACGTGATGCTATGTG (CTT)4 65° 186–192 4 0.47 0.57
R_ATCGATCTCACTGACCATGT
Dec24 KT587708 F_TAAAGAAACATGGGCCGGTA (GCC)5 65° 210–226 5 0.73 0.86
R_TTATTCCTGGGATTGGGTTG
Dec26 KT587709 F_TCGGAAAACGCAGGAGAG (CA)6 65° 180–190 4 0.68 0.59
R_GTTCAGTGGGTCTGGCTTGT
Dec27 KT587710 F_TGTACATGAATGGCAGCACA (AGAT)3 65° 248–262 6 0.73 0.76
R_AACAGCAGCAGAGATGACGA
Dec28 KT587711 F_GTTCCTCCCAAGAAACCACA (AC)6 65° 146–180 8 0.78 0.84
R_CCCAACATTCACCTGGTTCT
Dec29 KT587712 F_TGTTATAATCATCACCATGCTC (GTA)4 65° 170–184 6 0.70 0.67
R_ACAGCTATTGCCACTACTTGA
Dec30 KT587713 F_CATTACGAGCACGCAGTCC (CA)7 65° 152–164 5 0.71 0.59
R_TACCACTGCTGGACACGAGA
Dec31 KT587714 F_CGTTGTCAGCACACACACAC (TCTA)3 65° 136–146 5 0.70 0.79
R_TACTACCACTGCTGGACACGA
Dec33 KT587715 F_TGTCGTGTGCGTTTTGTTTT (CTT)4 60° 274–336 8 0.78 0.94
R_CTAAGATCCCCACTCCCACA
Dec35 KT587716 F_TTCTTGGACACACAGCCTTG (TG)4 65° 274–290 6 0.72 0.88
R_GGGCTGAAAACATCATCACC
Dec36 KT587717 F_GAAGGTGATGATCGGCAGTT (GCAG)3 65° 280 1 0.00 0.00
R_GTGTGCGTTGCTGCCTACTA
Dec37 KT587718 F_CCTCTCTTCCGTTTGCTCTG (GTG)5 65° 198–218 5 0.70 0.81
R_TGAACAGGCACGGATTGATA
Dec39 KT587719 F_TAGGTGTCCCATTGGTCGAT (GT)7 55° 166–182 5 0.64 0.34
R_AGGAGAGCTGCGTGTCATTT
Dec42 KT587720 F_CACGTCATGTACTGCGATCC (GT)6 65° 220–230 3 0.56 0.68
R_GCGTCACACATACACACACG
Dec43 KT587721 F_CAGTCATCAGCATTCAGGTAT (TG)11(AG)6 65° 212–228 5 0.74 0.91
R_ATAACTTGCGTATGTGCTCTC
Dec44 KT587722 F_CATGCTTAATCCAGAAATCAG (AC)12 65° 182–226 6 0.78 0.94
R_TGTAAACCGGAAAGTGTACTG
Dec45 KT587723 F_TGGAGATGGAGATGGGAGTC (GGAT)3 65° 210 1 0.00 0.00
R_CCCAAGGAATGGGATAGGTT
Dec47 KT587724 F_AGAGAGCTGATGGTCGTGGT (GA)9 65° 210 1 0.00 0.00
R_TGGAAACTTGGGAGGATCTG
Dec48 KT587725 F_CTAACGCTATTGCTTTGCTT (CT)45 65° 144–190 10 0.85 0.94
R_TGCAGAGAGAGAGAAGAGAGA
Dec49 KT587726 F_CAATGCATGCTTGGAACTTG (GT)6 65° 166–180 5 0.65 0.74
R_CATCGGAGGGTAGATTGGTC
Dec50 KT587727 F_GAAACAGGACCATCAGATAGCA (CA)6 65° 164–180 5 0.76 0.84
R_GGAATCTGCAGGTTTGGAAG
Dec51 KT587728 F_GCTGATCCTCGGATTGTGTT (TG)21 65° 248–262 5 0.69 0.92
R_TAACTTGGACGCGCTAAAGG
Dec52 KT587729 F_CACGAATGCACATGCAATAA (GT)6 65° 289–292 2 0.00 0.00
R_AGTGAACCAAACTGCCAGAA
Dec54 KT587730 F_GCCCTCTTTAACTCTGCTTTA (CA)8 65° 236–252 5 0.75 0.92
R_GTATCTTCTTTCGGATGACCT
Dec55 KT587731 F_AGCACCATCATCTTTAACAAA (ACACC)3 65° 212–224 6 0.78 0.73
R_CAAGGAATTTGCACTAAAAGA
Dec56 KT587732 F_GAACTTAATGGCGGAGTAGAC (AG)14 55° 220–230 2 0.00 0.00
R_CACAGATTGCTGAATTGTTTC
Dec58 KT587733 F_ATTAGGATTGCGCACTGGTC (GT)6 65° 286–298 5 0.64 0.8
R_ATCCGCATTCACAACCTCTC
Dec59 KT587734 F_GGTTAAAATGGTTCGCTGGA (GT)7 65° 184–220 5 0.73 0.92
R_ACCTAGGCTCGCATGACAAT
Dec60 KT587735 F_ATTTCAGTTGCACATTCCA (GT)6 55° 220–230 2 0.00 0.00
R_TCCAAAACTTAGCTCAGAAAG
Dec62 KT587736 F_AGGAAGGGTACGGTGTAGGC (CA)7 65° 216–238 4 0.41 0.59
R_TCTACATGCACATCCGGAAA
Dec63 KT587737 F_GGGATATTTTCCGGATGT (CTT)4 65° 218–226 3 0.51 0.7
R_CAGAGCTCAGAAAGTCGTTAC
Dec65 KT587738 F_TCGGATTCTTGGACAACCTC (GGCC)3 65° 180 1 0.00 0.00
R_CCTCTACGCGAAAGATGGTC
Dec69 KT587739 F_GATGGCTACCTGCATTGGAT (CCAT)3 55° 168–180 6 0.79 0.96
R_ATAAGGGGAGCCCTCAAAAA
Dec70 KT587740 F_AGCTGCCTCCACTTGACAAT (TG)7 65° 256–268 5 0.72 0.62
R_AGGCCCTGATAGTCCCCTAA
Dec71 KT587741 F_GAGCTTCCCTGTGTCTGATA (TG)10 55° 234–254 4 0.62 0.84
R_ATGACAATGACTATGCTGACC
Dec75 KT587742 F_ACAGGAGCCTTTATGCATGG (ATGC)3 65° 150–166 5 0.68 0.69
R_GTCCTGTGTTGGTCGTTCCT
Dec76 KT587743 F_GTCACGTGCCATCACAAATC (TAGC)3 65° 270 1 0.00 0.00
R_GCACACATGCATGATGACAA
Dec77 KT587744 F_TCCAAATGTACCGTCAATAAA (AG)12 55° 234–260 7 0.76 0.9
R_CGTGTCTGCATTCAAAGTG
Dec78 KT587745 F_GCTTACCACATCCGGTGATT (AC)8 65° 246–260 5 0.66 0.71
R_GAGAATGCTTCCCGTTCTTG
Dec83 KT587746 F_GGCTTGCTCCAAGAGATGAG (CA)20 65° 174–198 4 0.66 0.72
R_TAGCTTGGCCTTTGTGTGTG
Dec84 KT587747 F_GGCTTGCTCCAAGAGATGAG (AC)9 65° 220–250 7 0.78 0.95
R_TTCGTCACGTCAAAACAAGC
Dec86 KT587748 F_CCACCTCCCAGGATAGATGA (TG)7 55° 140–180 9 0.80 0.94
R_AGATTGGGGGAGGAAGAAGA
Dec89 KT587749 F_CTGTTGCATCCACCACTTTTT (TC)8 65° 146–180 4 0.55 0.41
R_CGGCAGCCTAAAGTGATTGT
Dec90 KT587750 F_CGGTGCTCCATGATTAGGAT (GT)8 65° 278–326 7 0.77 0.82
R_GCGTAGCATCATCGAGAACA
Dec91 KT587751 F_GCCTCATCTGTTCATTCATT (TG)7 55° 290–330 3 0.26 0.22
R_TGGCACTCTAACTTGTAGGC
Dec92 KT587752 F_AGCAATCCAAGCTGAAAGGA (AC)7 65° 264–290 7 0.79 0.92
R_TTCCGCATGAAACAAAACTG
Dec93 KT587753 F_TTCGGTCAAAATCGAAAAGG (AC)6 65° 226–244 5 0.72 0.95
R_GCATTGTTTCAGAGGCTTCG
Dec95 KT587754 F_AGCAACCCAAAGGTCAGCTA (CT)24 65° 178–208 6 0.71 0.89
R_AGGAGGGATTCAAGGGAGAA
Dec96 KT587755 F_CATTCTGGTATGGCACGTTG (CA)6 65° 148–154 4 0.66 0.85
R_ATTTACCGACCAGGCTGAAG
Dec97 KT587756 F_GGGCAGGCACTAGATTGATT (TCTT)3 65° 176–184 4 0.61 0.72
R_TTGCTTGCTTGAGTTTGTGG
Dec98 KT587757 F_TAGGTGACAAGGCACGATCA (AG)10 65° 252–272 7 0.76 0.95
R_GGGCCAACATACCAAAGAGA
Dec99 KT587758 F_TAAGAGACGAGTGCTCTGAAA (AGCAGG)3 65° 210–228 7 0.77 0.91
R_TTGTGAATCGGTACTTTTGTC
Dec101 KT587759 F_CTCTAACTTTCGGCGTGGTC (GGCC)3 65° 224–230 3 0.53 0.71
R_GGACGGTCCGACTTGTCTAA
Dec103 KT587760 F_ATGACGAACTTGCTCCCTACA (AC)8 55° 176–206 4 0.51 0.71
R_ATCGATTCAGAGCCGCTTC
Dec105 KT587761 F_CCTTCTGTTCATTGCAGTCC (TG)8 65° 174–180 4 0.56 0.65
R_TGGTACCACAATGCCAAATC
Dec106 KT587762 F_TCACGAACAACGATCAGAGC (TG)7 55° 180–230 7 0.74 0.93
R_TCTTTACCCGTGCTGTTTCC
Dec108 KT587763 F_CATCACCGCATTTATGCAAG (AG)8 65° 184–200 6 0.68 0.85
R_ACACACGTCCTCGTCTTCCT
Dec109 KT587764 F_CAGCACACTGAATCCTCTGC (GT)6 65° 216–220 3 0.39 0.59
R_CCGTTGTTCCATCAGAACCT
Dec110 KT587765 F_CTCCGAAGATCCGAGCTATG (GT)7 65° 178–184 4 0.31 0.41
R_CCCCTGGAGGCTATAAAAGG
Dec111 KT587766 F_TGATTAGGTGCTGACTGCTG (ATTT)3 65° 178–186 5 0.50 0.57
R_CTGGAAGATGTATTTGGTGTGA
Dec112 KT587767 F_CCTCAAGAAGCTCTGGGATTT (TGTT)3 55° 238–244 4 0.57 0.72
R_TGTGCAAACGTCAGTAGAGCA
Dec113 KT587768 F_TGGACTAACTGCACTGCCTGT (GT)9 65° 208–224 7 0.74 0.94
R_CATGAGGAGCACAGCGAATA
Dec114 KT587769 F_CAAAGGCCATGCCTTGTACT (GT)11 65° 214–220 4 0.62 0.72
R_CACTGCTCAGCCAATCCTAAG
Dec115 KT587770 F_GGCATATGTCTGAGTAAGTGTG (TCT)4 55° 160–174 6 0.76 0.6
R_CCTGTTTCCATTGATTCTTTT
Dec116 KT587771 F_TCACTTCATCCATTCGCTTG (TG)17 65° 274 1 0.00 0.00
R_AACATGACCGACTCCTACGG
Dec118 KT587772 F_ACACACCCCAACTCACACAA (AC)6 65° 208–226 6 0.75 0.83
R_TGGTCATGGCAAAAGATGAA
Dec121 KT587773 F_TGCACAATGATGAACACAGG (GT)7 65° 226–264 6 0.74 0.74
R_AGTGAACCAAACTGCCAGAA
Dec122 KT587774 F_CCTGCGTCACTCGAGAAAA (TCTG)3 65° 268–292 6 0.76 0.93
R_CAATGTCATCGCCATTTCTG
Dec123 KT587775 F_TGAGCAACACTGGAGAATGG (TC)9 65° 248–280 9 0.80 0.94
R_CGTACATGACAGGAGGGTGTT
Dec124 KT587776 F_AGAAGCCCCAGATGTTCTGA (GT)9 65° 270–306 4 0.52 0.69
R_GCTAGTCGCGTCTACCGTTC
Dec125 KT587777 F_TCTGGGGTGGAAATGTTGAT (CT)11 65° 202–214 4 0.61 0.34
R_CCCTTCACCTTGAGAAAGCA
Dec126 KT587778 F_GGATGGATTGATGGATGCTT (GGCC)3 65° 268–304 7 0.77 0.93
R_AACCCGAAAGGCCTAAGCTA
Dec127 KT587779 F_CGTTGATCACACGTCTCAGG (TTGC)3 65° 250–280 4 0.65 0.75
R_GATTTCGCCACCAACATTCT
Dec131 KT587780 F_CTTGTTACCTTCTGCACAATAAA (GAA)5 65° 160–170 3 0.00 0.00
R_ATTAGTCTTTCCGTCCTTGTC
Dec132 KT587781 F_GTATCGGGTAGCAAGGCAAG (AAGC)3 65° 220–240 2 0.00 0.00
R_GGAAATTCCTTACCCCGAAG
Dec133 KT587782 F_GGATGGAAGAGCACAAAAGC (CT)7 65° 218–228 5 0.68 0.81
R_GCGTGTGTGTGTGTGTTTGA
Dec134 KT587783 F_CAGGCTTCCCCTCTCTCTCT (AC)7 65° 220–260 8 0.76 0.93
R_GCAACCGGAAGAATTCATGT
Total average       4.93 0.68 0.77
  1. aAmplification temperature (°C)
  2. bMaximum number of alleles observed
  3. cPolymorphism information content
  4. dDiscrimination power