Skip to main content

Table 1 13 Microsatellite loci, primer sequence, repeat motif, primer sets, PCR conditions and accession-numbers

From: First establishment of microsatellite markers in clausiliid snails (Mollusca: Gastropoda: Clausiliidae)

Locus name Primer sequence (5′–3′) Repeat motif Multiplex reaction Labelling dye Primer conc. TA Accession-Nr
Mont_13187 F: TGCCTGCAGTGCGTAGAG CATA R1 VIC 2 61/57  KY094088
R: TATTGATTTCGGACAGGGCG       
Mont_13385 F: GGTAAGCCAATAACGGTGGC TCTT R3 PET 2 58/51  KY094089
R: ATCTGCAACGCCAGTAAACG       
Mont_17419 F: ATAATGTGGGCAGAACAGGC CAAA R2 6-FAM 0.5 58/51  KY094090
R: GTCTTGGGTCGCACAGAATG       
Mont_2349 F: TGACCCGCAGTGATCAAGTC TTTC R2 VIC 2 58/51  KY094091
R: ATCCTATTTCGGTCCCTGGC       
Mont_2916 F: CGTTGAATGAGTCACGGACG GAAA R3 VIC 3 58/51  KY094092
R: ACACTTGTAGGCCGTTGTTC       
Mont_3056 F: GAAAGAAGACCCCATTACGCC AAAG R1 6-FAM 1 61/57  KY094093
R: ATAGCGCACGTCTTTTGTCC       
Mont_3943 F: CGATGATACAAGCAATGCGG TCTT R3 NED 2 58/51  KY094094
R: CCATAGCTGCGTGCTTACAG       
Mont_4042 F: AGCTAAAGTATCGTTGTATGGAGG TCTT R1 PET 2 61/57  KY094095
R: CTCCGAGCATGAGCTTTCTG       
Mont_4196 F: TCAGCCCTGCACAGATAGAC AAGA R2 PET 2 58/51  KY094096
R: ACCTGGACAGCAGTTCTACG       
Mont_4477 F: GTCTGACACAGGCAGCATAC TTCT R2 6-FAM 4 58/51  KY094097
R: CGTTGGTCTCCCGATTTCAC       
Mont_5483 F: ATTCAATGTGCGCAAGTACG TTTC R1 NED 3 61/57  KY094098
R: TGTCATTGATAGCCCCCTCC       
Mont_5717 F: TATGGCCAACGAAACCAAGC AATC R3 6-FAM 2 58/51  KY094099
R: GTTCCGCATGGGACATGATAC       
Mont_5741 F: TGGTATTGAGTGCATAGACGC GTTT R3 6-FAM 2 58/51  KY094100
R: CATTCTGGCGGGGATAAAGC       
  1. Primer Conc. primer concentration in pmol; T A Annealing temperature (°C), 2-step thermoprofile (hot-start TA/regular TA); Labelling dye DS-33 dye set