Skip to main content

Advertisement

Table 1 Primers used in the PCR–RFLP analyses

From: Genetic polymorphisms in Plasmodium falciparum chloroquine resistance genes, pfcrt and pfmdr1, in North Sulawesi, Indonesia

Pfcrt
 1st amplification
  pfcrt76F1st
  GCGCGCGCATGGCTCACGTTTAGGTGGAG
  pfcrt76R1st
  GGGCCCGGCGGATGTTACAAAACTATAGTTACC
 2nd amplification for PCR–RFLP
  pfcrt76F2nd
  TGTGCTCATGTGTTTAAACTT
  pfcrt76R2nd
  CAAAACTATAGTTACCAATTTTG
 2nd amplification for NGS amplicon sequencing
  pfcrt76F2ndNGStag
  ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNTGTGCTCATGTGTTTAAACTT
  pfcrt76R2ndNGStag
  GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNCAAAACTATAGTTACCAATTTTG
pfmdr1
 1st amplification
  pfmdr86F
  GCGCGCGTTGAACAAAAAGAGTACCGCTG
  pfmdr86R
  GGGCCCTCGTACCAATTCCTGAACTCAC
 2nd amplification for PCR–RFLP
  pfmdr86F
  TTTACCGTTTAAATGTTTACCTGC
  pfmdr86R
  CCATCTTGATAAAAAACACTTCTT
 2nd amplification for NGS amplicon sequencing
  pfmdr86F2ndNGStag
  ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNACCGTTTAAATGTTTACCTGC
  pfmdr86R2ndNGStag
  GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNCATCTTGATAAAAAACACTTCTT