Skip to main content

Table 1 Description of 14 SSRs developed for Prosopis africana

From: Fourteen simple-sequence repeats newly developed for population genetic studies in Prosopis africana (FabaceaeMimosoideae)

Locus Primer sequences 5′–3′ Repeat typea Size bpb No of allelesb Genbank accession number
Proafr_01109c F TGATCGCGTTGTTTACTTTTGC (TG)14 162–185 6 KU726842
R GGGCTTGGTCCAGTTGTTATC
Proafr_01293c F TTTGGAGCAGTAACGCAAGC (AG)16 149–194 12 KU726843
R AAAAGGCTAAACGGACTGGG
Proafr_01664c F TGGACAAATCAAGCCTTATCACC (AC)13 133–157 7 KU726844
R AGCATGTTCGTATTGTTGCC
Proafr_03430c F ACAGTTTCCGGTGATACTCATTC (AG)15 232–253 10 KU726845
R TGGCCAATACAACGGGAAG
Proafr_03572c F AAAGCGTCATGAGACCAAGC (TC)17 232–253 5 KU726846
R GAAGCTGTTTGGTCAGCCAC
Proafr_05728c F GTCCACATTTCTGAAGACACCC (CT)13 124–140 7 KU726847
R ACACGTGGTTTAATCTGATGC
Proafr_08290c F GGCTCAAGCCCTGAAACATAC (CT)16 168–210 11 KU726848
R ATTTGGAAAGAGCCACCTCC
Proafr_08425c F TTTCCTACGACGCTCCCATC (CT)14 203–221 8 KU726849
R ACGATGCTAACGTCTCTTTTGG
Proafr_09196c F TGTCTTTCGAACCCTATTAGCAC (TC)15 251–266 6 KU726851
R ACTTGACAAAGGAAAATTAAGGCG
Proafr_10663c F CACCTCTATAATATGTGCGTGC (AG)14 081–114 8 KU726852
R ACTTTCACTAAGTTGCCCCTAC
Proafr_11069c F TTTGTTCAGCGTAGCCTGTC (AC)13 218–234 6 KU726853
R GACCGACAAATGAAGTCCCAG
Proafr_11635s F TTGGCGCAAAAATGGAGGTC (AG)16 132–144 6 KU726854
R ATGCATCGTCCTATTCCCCC
Proafr_12199s F GCGTTTGACAACTGCGTAGC (TC)16 129–173 14 KU726855
R TGCAACTGGGGAAGATTTATGTG
Proafr_12745s F TTAGGCAAGAGATCCCCGTG (CT)14 205–225 8 KU726856
R AGCTTGTGGTCGTGGATTTG
  1. aBased on genomic DNA sequence analysed on a Illumina MiSec platform
  2. bBased on the fragment analysis of 15 individuals on an ABI3730