Skip to main content

Advertisement

Table 1 Summary information for the 15 microsatellite markers used in this study of Vulpes lagopus

From: Fine-scale population genetic structure of arctic foxes (Vulpes lagopus) in the High Arctic

Locus Primer sequences (5′ to 3′) Repeat motif Size range (bp) Number of alleles Ho (He) PCR multiplex Ta (°C) F IS F null
CPH5 [12] F:FAM-TCC ATA ACA AGA CCC CAA AC (TG)17 84–112 14 0.788 (0.845) 1 57.4 0.070 0.038
R:GGA GGT AGG GGT CAA AAG TT
CPH9 [12] F:PET-CAG AGA CTG CCA CTT TAA ACA CAC (GT)18 152–164 6 0.671 (0.667) 1 57.4 − 0.004 0.001
R:AAA GTT CTC AAA TAC CAT TGT GTT ACA
CPH15 [12] F:FAM-GCC TAT ATA AAA TGC ATC TGA GC (AC)18 111–139 14 0.876 (0.890) 1 57.4 0.017* 0.015
R:CCG TGA CTC CTG TCT TCT GAC
CXX147 [13] F:NED-CCA TGG GAA ACC ACT TGC (AC)20 168–188 11 0.852 (0.842) 1 57.4 − 0.010* 0.009
R:ACT TCA TCA TGT CTG GAA GCG
CXX173 [13] F:NED-ATC CAG GTC TGG AAT ACC CC (TG)17 124–132 5 0.667 (0.739) 1 57.4 0.100 0.039
R:TCC TTT GAA TTA GCA CTT GGC
CXX250 [13] F:PET-TTA GTT AAC CCA GCT CCC CCA (AC)18A2(TC)4 120–140 11 0.862 (0.862) 1 57.4 0.007 0.009
R:TCA CCC TGT TAG CTG CTC AA
CXX733 [15] F:VIC-CCCTCTACTTATGTCTCGGCC Dinucleotide 245–271 12 0.576 (0.706) 1 57.4 0.187* 0.090
R:GAGAGGAGAAACAACCAACACC
CXX758 [15] F:NED-AAG CAT CCA GAA TCC CTG G Dinucleotide 213–253 17 0.857 (0.872) 1 57.4 0.019 0.020
R:GTT GAT TGG GAG ATA ATC CAC A
CXX771 [15] F:VIC-GAG GAA GCC TAT GGT AGC CA Dinucleotide 85–123 17 0.824 (0.851) 1 57.4 0.034* 0.018
R:CAA GAC CTG AAT TCC TTG TTC C
CPH3 [12] F:NED-CAG GTT CAA ATG ATG TTT TCA G (GA)2TA(GA)17 156–188 16 0.886 (0.888) 2 49.9 0.005 0.010
R:TTG ACT GAA GGA GAT GTG GTA A
CXX20 [13] F:PET-AGC AAC CCC TCC CAT TTA CT (CA)21 121–139 10 0.823 (0.848) 2 49.9 0.031 0.003
R:TTG ATC TGA ATA GTC CTC TGC G
CXX140 [13] F:FAM-CAG AGG TGG CAT AGG GTG AT (GT)15 137–161 11 0.790 (0.815) 2 49.9 0.033 0.009
R:TCG AAG CCC AGA GAA TGA CT
CXX745 [15] F:FAM-TTT ATG GTC TCC ATG AGG GC Dinucleotide 267–283 9 0.866 (0.850) 2 49.9 − 0.016 0.000
R:TCC CTG CAT TTC CTT ATT TCA
CXX671 [14] F:VIC-AAA ATG AAA AAG GAA GAG AGC (CA)10 199–215 9 0.880 (0.840) 2 49.9 − 0.044 0.000
R:AGG AGA CAG GAT TTT CCT CTC A
CXX377 [14] F:VIC-ACG TGT TGA TGT ACA TTC CTG (AC)12 173–193 11 0.843 (0.863) Singleplex 58 0.026 0.016
R:CCA CCC AGT CAC ACA ATC AG
  1. Size range, number of alleles, observed heterozygosity (Ho), expected heterozygosity (He), annealing temperature (Ta), inbreeding coefficient (FIS) and null allele frequency (Fnull) are provided for each locus
  2. * Significant deviation from Hardy–Weinberg equilibrium after Bonferroni correction