Skip to main content

Table 1 Characteristics of 35 microsatellite loci in n = 33 Sylvilagus transitionalis and cross-amplification in n = 6 S. floridanus

From: Microsatellite marker development from next-generation sequencing in the New England cottontail (Sylvilagus transitionalis) and cross-amplification in the eastern cottontail (S. floridanus)

Locus Primer sequences Repeat motif Genbank accession number Allele size range A Ae He Ho F P value Number of alleles in S. floridanus
StrQ2 F: *TGTCTGGCTTATGAGAAAGGG
R: ACTGCGGGACTTCATACTGC
AGC KX530819 129–153 5 3.0 0.68 0.61 0.09 0.107 4
StrQ7 F: *TCGCTCTCTGTCTCTGCCTT
R: GCCTGCACTCTCTAGCTTGG
ACT KX530820 116–122 2 1.6 0.39 0.39 − 0.03 1.000 5
StrQ8 F: *TCCTGCCTTTGAGAGCATTT
R: TGGGTGATGCCTCACTTAAT
AGAT KX530821 149–169 6 2.8 0.65 0.66 − 0.03 0.813 5
StrQ10 F: TGATAGGAAGGTAAGTCAGTGGG
R: *TGCTCTCAAGAACCCAGGAG
AGAT KX530822 120–132 4 2.0 0.50 0.47 0.04 0.184 0
StrQ11 F: *ATCGAATTTCGTCTGCATCC
R: AAGGGTAGCTCTCAAACACCA
ATCC KX530823 188–192 2 1.2 0.14 0.15 − 0.08 1.000 5
StrQ12 F: TGATTCGGAGTGGTTATGAAGA
R: *ATTGCAATGCCCAACACTG
ATC KX530824 132–135 2 1.1 0.12 0.12 − 0.07 1.000 6
StrQ15 F: *GATGGTGGATAAGATAGAGGACA
R: TATGGCTGGACCACACTCTG
AGAT KX530825 177–193 5 2.9 0.67 0.58 0.12 0.110 4
StrQ16 F: *CAGATTGACGTTGAGCAGA
R: TGCTTGCCTCTTTCAAATAAA
AGAT KX530826 144–152 3 2.4 0.58 0.64 − 0.11 0.677 4
StrQ18 F: *ACTCAGAGATAATGCACCAAA
R: AAGGGTTAGATGGCAAGGGT
ACT KX530827 215–221 3 2.4 0.59 0.58 0.01 0.173 6
StrQ19 F: ACCATCCATGACTGGTGAAA
R: *GCACATGGGACATAGAAGGC
ATCC KX530828 154–166 3 1.9 0.47 0.31 0.32 0.016 3
StrQ20 F: TGATTGCCCAGAGAATTAGTACC
R: *AGGTCTTCAGACTCACTCTGGT
ATCC KX530829 201–217 2 1.5 0.36 0.39 − 0.12 1.000 6
StrQ21 F: *TTCAATTTGCACCAAGAAGC
R: CACAAGGTAGCATACTGTGGC
ATCC KX530830 188–192 2 2.0 0.50 0.42 0.13 0.484 3
StrQ23 F: *AGCCTGCATCCTTTAGGG
R: GCATAAAGGTTAATGAATAAGATTGC
AGAT KX530831 207–211 2 1.1 0.06 0.06 − 0.03 1.000 3*
StrQ24 F: TGCGACTATTTCCAAAGCAT
R: *TTGTTAGTTTCTCACAGTGCTGC
AGAT KX530832 200–212 4 2.4 0.60 0.61 − 0.03 0.752 4
StrQ25 F* TGCATATTTGTCTTTCATTCTCTGA
R: AACAATGACAAATTACACAGCCA
AGAT KX530833 127–135 3 1.4 0.30 0.30 − 0.04 0.631 5*
StrQ26 F* CCTCTCTGAAACTATGCCTTTC R: CCTACAGCACTCCTGACTCGT AAGG KX530834 144–160 5 3.4 0.71 0.65 0.08 0.806 6
StrQ27 F:*TTCATCATCTTGTTATTTCATAGAGAA
R: TGGAGCTCTTGGAGTCTAATGTG
AAGG KX530835 142–154 4 2.7 0.63 0.64 − 0.02 0.623 4
StrQ28 F: *GGAAGAAAGGAAGAAAGGAAGA
R: GGAGACTTGGATTGAATTCTGG
AAGG KX530836 200 1 1.0 0.00 0.00 N/A N/A 5
StrQ30 F:*CTTAATTGTAAGGAGGGTAGGAAA
R: CCTCTTTCTCTCACTAATGCTGTT
AAGG KX530837 102–138 6 3.8 0.75 0.73 0.02 0.436 0
StrQ31 F: *TCAAGCACAGAACAGAGCAG
R: CCTTCTATTCCTTCTTTCTTCCTTC
AAGG KX530838 130–134 2 2.0 0.50 0.46 0.08 0.726 5
StrQ32 F:*TGTAACTCTGCCTTCCAAATAAATAA
R: GGCTGTTTAACTTGCCATGC
AAGG KX530839 182–198 5 2.7 0.64 0.61 0.04 0.768 5
StrQ34 F:*TTAGAACGAACAAGAAAGAAAGAAA
R: TCAAGTGGGAAAGGAATATCAA
AAGG KX530840 148–156 3 2.5 0.62 0.58 0.05 0.415 4
StrQ37 F: *TTGTATGTGAACTTTGCACCG
R: CACAGTCTAACTCTATCTGTCAAGAAA
AAGC KX530841 94–106 2 1.5 0.34 0.24 0.28 0.123 6
StrQ39 F: *TCAAAGCACTTAATTCAAATCCC
R: GTCTCTCCAAGCCTCCTCCT
AAGC KX530842 192–196 2 1.9 0.48 0.33 0.29 0.135 2
StrQ41 F: *CCCTCTCTGTAACTCTGTCTTTCA
R: TGAGGTACATTCAGCAGCCA
AAGG KX530843 196–216 4 2.1 0.52 0.42 0.18 0.468 3*
StrQ42 F:*AGAAATAAAGAATAGCTTGGATAAATG
R: CCTTCCTTCGTTCCTTCGTT
AAGG KX530844 120–132 4 3.5 0.72 0.82 − 0.15 0.253 4*
StrQ43 F: *GTATCTGCCGAATGAAGTGGA
R: TAGGTACAGATAATTCACTTTGGACA
AAGG KX530845 218–230 3 1.9 0.49 0.55 − 0.13 0.637 3*
StrQ44 F:*TTATTTATTGGAAAGGTAGATAGGTGA
R: TGGGTTATTGGCACTCACAA
AAGG KX530846 230–234 2 1.3 0.26 0.24 0.06 0.551 4*
StrQ45 F: *CGACTAGGATAAATGCCACAGA
R: CCCAATCCCTACACAACTAACAC
AAGG KX530847 124 1 1.0 0.00 0.00 N/A N/A 1
StrQ46 F:*AAATGAGGAATATTTGTTGAATGC
R: AGAATGAACCAGCAAATGGG
AACT KX530848 120–144 6 2.4 0.59 0.70 − 0.20 0.359 3
StrQ48 F: *GGGTTTGATGCTGAGGTCC
R: TACATCCAGTGCACATTCGC
AACC KX530849 118–122 2 1.1 0.06 0.06 − 0.03 1.000 2*
StrQ49 F: *ATCTTAGTGGAGAGAGTGGCTTG
R: AAGTTCACCAGGCTAACTAGAGGA
AAAT KX530850 120–132 4 3.0 0.68 0.58 0.14 0.178 1
StrQ63 F:*AAACAAGGAGATGTCACAGTAGTTTAG
R: CATCCCTCTCTGTAACCTTGACTT
AATT KX530851 126–130 2 1.3 0.24 0.21 0.10 0.467 2*
StrQ67 F: *TCTTGTCAAGTTTGTAACATGTGC
R: TCAGCTTAACCCACTGTGCC
AATG KX530852 246–254 3 1.3 0.22 0.24 − 0.12 1.000 2
StrQ72 F: *GCCTCTGCTTCTCTGTAACTTTG
R: GGTTGGGAGGAGGCTTAGAG
AATC KX530853 136 1 1.0 0.00 0.00 N/A N/A 1
  1. Locus refers to the name assigned to the microsatellite containing sequence. Primers sequences with a * denote which primer was tagged with an M13 tail. The number of alleles (A), effective number of alleles (Ae), unbiased heterozygosity (He), observed heterozygosity (Ho), and fixation index (F) were output by the GenAlEx software. The Hardy–Weinberg P value is the P value reported across loci from Genepop using Fisher’s method. The Number of alleles in S. floridanus refers the number of alleles at each locus observed in S. floridanus, where a * denotes a putatively species specific amplification pattern not observed in S. transitionalis