Skip to main content

Advertisement

Table 1 Multiplex sets for sooty tern (Onychoprion fuscatus) microsatellite genotyping including three sex-typing markers

From: A multiplex marker set for microsatellite typing and sexing of sooty terns Onychoprion fuscatus

Locus Clone name, NCBI accession number/references Repeat motif Primer sequence (5′–3′) Multiplex/fluoro-label (F) n A Observed (expected) allele size range (bp) HO HE P HWE Est null allele freq.
Ofu1 Trn17616 CA(17) F TGTTTAAGCAGTAAAGACAAAGCCTAC 7/NED 22 12 202–227 0.96 0.89 0.76 − 0.05
  LT903723   R GGTGCGTTTAGAGTGCTTCTTTAG     (211)     
Ofu2 Trn23851 AC(15) F GGCTGTAGCGAGCAGTTAGG 2/HEX 22 8 189–359 0.78 0.80 0.74 0.02
  LT903724   R GAAGCTTGGGTGCAGGTG     (209)     
Ofu3 Trn25452 CA(16) F GGCTGTAGCGAGCAGTTAGG 5/6-FAM 23 10 144–166 0.78 0.80 0.43 0.01
  LT903725   R GAAGCTTGGGTGCAGGTG     (170)     
Ofu4 Trn4256 AC(18) F CCTGTTGCCAAGAAATAAATCTTAC 5/HEX 22 13 141–175 1.00 0.89 0.29 − 0.07
  LT903726   R TGAAGAAGCGTGGCTGTG     (150)     
Ofu5 Trn171 TG(21) F TCCCTACTTGACTTTGGAAACATC 4/6-FAM 20 12 86–131 0.95 0.91 0.81 − 0.04
  LT903727   R TGTACAACACTGTTCCATCATGC     (103)     
Ofu6 Trn352 CA(16) F GCGTTCGGCATCAAGTTAG 7/HEX 22 9 265–281 0.86 0.83 0.90 0.05
  LT903728   R ATCCCTGCAAAGCACACAG     (282)     
Ofu7 Trn436 TG(19) F TTGCTACAAACCTTGGTTATTGAC 4/NED 22 10 154–184 0.77 0.85 0.23 0.04
  LT903729   R GCAACCTTAGCATTACCTAGCTG     (165)     
Ofu8 Trn640 GA(15) F GGGTTACTGCTGGTCAGAGC 1/6-FAM 23 14 272–328 0.91 0.85 0.63 − 0.06
  LT903730   R GCTCTAGGCCAATTTCATCATC     (289)     
Ofu9 Trn643 TG(20) F CTAAGCTGAAATTCCTGAACTGG 6/6-FAM 23 14 174–206 0.96 0.92 0.40 − 0.03
  LT903731   R CAACTACAGACATCCCACAAGC     (185)     
Ofu10 Trn16824 CTT(26) F GGAAGGAGCATTCAGTCTGC 2/NED 20 17 132–210 1.00 0.95 0.91 − 0.04
  LT903732   R GATGCTCAGATGCTTGCTAGG     (167)     
Ofu11 Trn13992 TATC(15) F AAAGTCTGTCACACATCCAACG 1/6-FAM 22 8 155–203 0.77 0.72 0.53 − 0.05
  LT903733   R CACGGTGCCAGTTAATAATGC     (203)     
Ofu12 Trn129 CT(14) F TTAAGCAGAAAGCCAGAGTGG 3/6-FAM 22 9 300–330 0.73 0.80 0.14 0.04
  LT903734   R CTTAGTGTGCTTGGTAAAGACTGAAC     (314)     
Ofu13 Ofu839 TCCA(14) F GAGGCCACCCTTACACCTC 6/HEX 22 8 142–171 0.86 0.83 0.46 − 0.04
  LT903735   R AAATGAGCTTGGCTTTACGC     (169)     
Ofu14 Ofu897 CA(14) F GATCTTTCCCAGTAGCACCTATG 4/HEX 19 7 350–365 0.79 0.82 0.63 − 0.00
  LT903736   R CCACCTGGCTGGATAACAG     (349)     
Ofu15 Trn191 CA(14) F AAAGAGTCTCCACCTGAAGCAG 2/6-FAM 22 10 333–354 0.86 0.86 0.97 − 0.02
  LT903737   R AGCAATATCCCTGGCAGTACC     (340)     
Ofu16 Trn484 CA(13) F TTTCCTCCTGAGACTTGCGTA 6/6-FAM 22 7 314–327 0.55 0.68 0.20 0.09
  LT903738   R AAACCAAACTGGCATCAAATAAGT     (324)     
Ofu17 Trn715 AC(12) F CACCTTATCAAGGGCAATGG 5/NED 23 10 185–207 0.74 0.87 0.11 0.08
  LT903739   R TTGGATGGATAAAGCAAGCTG     (194)     
Ofu18 Trn269 TC(12) F ATCCCTGTCACTCCCATGAC 1/HEX 22 5 298–306 0.64 0.76 0.25 0.08
  LT903740   R TGCACATGGAAAGTTGCTTC     (303)     
Ofu19 Trn15 AC(12) F TTAGCCCTTTACCCAAATGC 6/6-FAM 23 8 94–116 0.74 0.72 0.95 − 0.03
  LT903741   R ATTACGTCAGCCTCCTCCAG     (115)     
Ofu20 Trn551 TTGG(11) F CCCAGTGACTCGCTTGCT 3/HEX 22 9 216–262 0.86 0.86 0.35 − 0.00
  LT903742   R CTGCAACAGCCTTTCAGTCA     (221)     
Ofu21 Trn121 GT(11) F GGCTTAGAAATACTGCCTTTGC 5/6-FAM 22 20 269–321 1.00 0.95 0.36 0.04
  LT903743   R CTGCTGGTCTGTAAACCATTTATC     (278)     
Ofu22 Trn652 AC(11) F TTTGCAACAGAAACCTTATCCTG 6/NED 23 6 152–164 0.70 0.70 0.35 − 0.00
  LT903744   R TATATTGCCTCTGGCCGTTG     (162)     
Ofu23 Trn407 CCAT(10) F CCTGCATATCCCAATATCATCC 1/HEX 20 10 142–183 0.80 0.86 0.53 0.02
  LT903745   R GGGAGGTTCAGGTTGTAATGC     (171)     
Ofu24 Trn442 ATCT(9) F ATGCATGGAAGCTGCTAACC 3/6-FAM 22 8 148–177 0.91 0.84 0.44 − 0.05
  LT903746   R ATCTGAGGTGGTCATCATTCTTAAC     (169)     
Ofu25 Trn126 TTTGT(8) F TAGACCAGGCTGCTCAAAGC 5/HEX 22 10 221–226 0.73 0.73 0.42 0.00
  LT903747   R TCCACCTCACCGTACTGGAT     (239)     
Ofu26 Trn825 AAAC(8) F CCTGGGAATAAACAGGAAAGC 4/6-FAM 22 4 189–198 0.64 0.59 0.59 − 0.05
  LT903748   R ATCAGCCAAGGTTTGACCAC     (190)     
Z002A [11] 2/6-FAM 13 M 1 249 (Z) 0
     10F 2 249 (Z) and 252 (W) 1.00
Z002D [11] 1/6-FAM 13 M 1 127 (Z) 0
     10F 2 122 (W) and 127 (Z) 1.00
Z43B [12] 7/6-FAM 13 M 1 270 (Z) 0
     10F 2 266 (W) and 270 (Z) 1.00
  1. NCBI National Center for Biotechnology Information; Primer sequence F forward, R reverse, https://www.ncbi.nlm.nih.gov/bioproject/PRJEB21955, n is the number of individuals tested and M is the number of males and F is the number of females identified using the sex-typing markers (Z002A, Z002B [11] and Z43B [12]), A is the number of alleles observed, HO is the observed heterozygosity, HE is the expected heterozygosity, PHWE is the probability of deviation from Hardy–Weinberg equilibrium, Est null allele Freq. is the estimated null allele frequency. The same PCR profile was used for all multiplexes as follows: 95 °C for 15 min, followed by 44 cycles of 94 °C for 30 s, 56 °C for 90 s, 72 °C for 90 s and a final step of 72 °C for 30 min