Skip to main content

Table 1 Sequence of primers used in PCR assays

From: Some coagulase negative Staphylococcus spp. isolated from buffalo can be misidentified as Staphylococcus aureus by phenotypic and Sa442 PCR methods

“Gene” Primer Sequence (5′–3′) Product (bp) Reference
cyd-aureus Forward CCCATTTGCTTGGTCTGTAGTA 432 This study
Sa442 Forward AATCTTTGTCGGTACACGATATTCTTCACG 108 Martineau et al. [4]