Skip to main content

Table 1 PCR primers used in this study

From: Phenotypic and genotypic detection of metallo-β-lactamases in A. baumanii isolates obtained from clinical samples in Shahrekord, southwest Iran

Primers Primer sequence Product size References
VIM-1 F
VIM-1 R
TGGTTGTATACGTCCCGTCA:F
TGTGTGCTGGAGCAAGTCTA R:
206 bp This study
IMP-1F
IMP-1R
TAACGGGTGGGGCGTTGTTCCT:F
CGCCCGTGCTGTCGCTATGAAA R:
bp 179 This study
OXA-51 F
OXA-51 R
TAATGCTTTGATCGGCCTTG:F
TGGATTGCACTTCATCTTGG R:
bp 353 Hu et al. [26]