Skip to main content

Table 3 Characteristics of eight microsatellite loci in two collections of Cicindela puritana

From: Development of microsatellite markers for three at risk tiger beetles Cicindela dorsalis dorsalis, C. d. media, and C. puritana

LocusPrimer sequencesSize rangeMotifLocus characteristicCR n = 24LCP n = 20
CpuQ1F: GCGACTTATATACAGTTAGTGGTGT218–251AAT(13)NA1.005.00
 R: TGTCTAACAATTCTCTCGGATTGC  HO0.000.65
    uHE0.000.71
    AE1.003.23
    Microchecker nullNoNo
    Micorochecker scoring errorNoNo
    HWE P-valueNA0.6889
CpuQ2F: ATAACGGGACACTGTGGACT135–183AAT(12)NA4.006.00
 R: ACACTTTGGCATTCAATTCGGA  HO0.500.30
    uHE0.660.74
    AE2.813.57
    Microchecker nullYesYes
    Micorochecker scoring errorNoNo
    HWE P-value0.16880.0000
CpuQ3F: CTTCGTACGTCATGAAAGTACTTAT196–214ACT(12)NA3.004.00
 R: AACTTCAAGCTTTCTGGATCAGA  HO0.600.40
    uHE0.500.38
    AE1.971.58
    Microchecker nullNoNo
    Microchecker scoring errorNoNo
    HWE P-value1.00000.4148
CpuQ10F: AAATTACGCGCGTGTACTGC124–136ATC(11)NA2.004.00
 R: AAGGGCTGATTCACGACACC  HO0.050.50
    uHE0.050.56
    AE1.052.19
    Microchecker nullNoNo
    Microchecker scoring errorNoNo
    HWE P-valueNA0.7256
CpuQ13F: AGTTTCGCCACAAATCCTGC116–140AAT(10)NA5.003.00
 R: GGTAGGACCACCGCAGAATC  HO0.750.25
    uHE0.680.66
    AE2.992.83
    Microchecker nullYesYes
    Microchecker scoring errorNoNo
    HWE P-value1.00000.0006
CpuQ19F: AGCAGCCACCTCTCTACACA156–168ACAT(9)NA3.003.00
 R: AGAGATATGTAGCCGGAAAGTAGC  HO0.200.15
    uHE0.410.44
    AE1.651.75
    Microchecker nullYesYes
    Microchecker scoring errorNoNo
    HWE P-value0.00530.0008
CpuQ23F: TGATATGTGTTGACTTGGTGTAATG146–162ACTAT(8)NA3.002.00
 R: ACCATAATGCAACTTTATACATATGCT  HO0.600.45
    uHE0.650.50
    AE2.751.96
    Microchecker nullNoNo
    Microchecker scoring errorNoNo
    HWE P-value0.23680.6748
Cpu31F: ATGATCTCCCGGTCTGTCCT152–192AAAT(7)NA3.002.00
 R: AATGTTCATTGATGTACTCGATCT  HO0.350.05
    uHE0.300.05
    AE1.421.05
    Microchecker nullNoNo
    Microchecker scoring errorNoNo
    HWE P-value1.00000.0000
    NA (mean, SE)3.00, 0.423.63, 0.50
    HO (mean, SE)0.38, 0.100.34, 0.07
    uHE (mean, SE)0.41, 0.100.50, 0.08
    AE (mean, SE)1.95, 0.282.27, 0.31
    HWE P-value (Fisher’s method)0.15230.0000
  1. “Locus” refers to the name assigned to the microsatellite containing sequence. “Size-range” is the bp size of the alleles genotyped. “Motif” is the repeat motif and number of repeats (in parentheses) identified from the sequence read in QDD. “Microchecker null” and “Microchecker scoring error” denote the results of tests in Microchecker for null alleles or scoring errors at each locus. The number of alleles (NA), effective number of alleles (AE), unbiased expected heterozygosity (uHE), observed heterozygosity (HO), were output by the Genalex software. The Hardy–Weinberg P-value is the P-value reported for each locus, and across all loci from Genepop using Fisher’s method at the bottom of the table. “CR” and “LCP” refer to the Connecticut River and Little Cove Point collections of Cicindela puritana. See “Methods” section of the text for details of these collections
\