Skip to main content

Table 2 Sequences of Tpi primers used in this study

From: Multiplex PCR for identification of two butterfly sister species: Eurema mandarina and Eurema hecabe

PrimerSequenceTarget speciesReference
Em4-F5′–GGCTCCAACAATTGGGAGATTA–3′Eurema mandarinaThis study 
Em4-R5′–TACAGGCAATGACCTTGAGGC–3′
Eh6-F5′–TGTGGCCTTCTGCCCTATTAAA–3′Eurema hecabeThis study 
Eh6-R5′–ACAGGCAATGACCTTGAGTC–3′
Tpi-F5′–GGTCACTCTGAAAGGAGAACCACTTT–3′Universal (Lepidoptera) Jiggins et al. [26
Tpi-R5′–CACAACATTTGCCCAGTTGTTGCAA–3′