A novel target enrichment strategy in next-generation sequencing through 7-deaza-dGTP-resistant enzymatic digestion

Table 1 List of the oligonucleotides used in the study

Oligonucleotide	Polarity	Sequence (5′ → 3′)	Position	Product size/note
HBVF1	Sense	actctctcgtccccttctcc	1479–1498	504 bp
HBVR1	Antisense	tgacggaaggaaagaagtcag	1962–1982
HBVR1^p	Antisense	^ptgacggaaggaaagaagtcag	1962–1982
HBVF2	Sense	ccttctccgtctgccgttc	1491–1509	488 bp
HBVR2	Antisense	ggaaggaaagaagtcagaaggc	1957–1978	488 bp
HBVF3	Sense	aacaggctttcactttctcgc	1082–1102	1311 bp
HBVR3	Antisense	cgagggagttcttcttctaggg	2371–2392	1311 bp
HBVR4	Antisense	^ptccacactccgaaagagacc	2257–2276
Splinter	NA	nnnnnnaggtgtgtSp3	To facilitate intramolecular ligation
HBVR5	Antisense	tgtgtgga	Target-specific RCA
C28	NA	Sp18nnnnn	Non-specific RCA

Position is according to the full-length HBV genome under GenBank accession number AB241115. Star donated phosphorothioate bonds to resist exonuclease activity of phi29 DNA polymerase. P in superscript indicated the modification of phosphate at the 5′ ends. C28 is the primer to eliminate primer-mediated artifacts from phi29 DNA polymerase-based multiple displacement amplification in our previous study [11]. Sp3, C3 spacer to block self-ligation of the splinter; Sp18, C18 spacer; NA, not applicable. All oligonucleotides were ordered from the Integrated DNA Technologies, Coralville, IA

ISSN: 1756-0500