Skip to main content

Table 1 List of the oligonucleotides used in the study

From: A novel target enrichment strategy in next-generation sequencing through 7-deaza-dGTP-resistant enzymatic digestion

Oligonucleotide Polarity Sequence (5′ → 3′) Position Product size/note
HBVF1 Sense actctctcgtccccttctcc 1479–1498 504 bp
HBVR1 Antisense tgacggaaggaaagaagtcag 1962–1982
HBVR1p Antisense ptgacggaaggaaagaagtcag 1962–1982
HBVF2 Sense ccttctccgtctgccgttc 1491–1509 488 bp
HBVR2 Antisense ggaaggaaagaagtcagaaggc 1957–1978
HBVF3 Sense aacaggctttcactttctcgc 1082–1102 1311 bp
HBVR3 Antisense cgagggagttcttcttctaggg 2371–2392
HBVR4 Antisense ptccacactccgaaagagacc 2257–2276  
Splinter NA nnnnnnaggtgtgtSp3 To facilitate intramolecular ligation
HBVR5 Antisense tgtgtg*g*a Target-specific RCA
C28 NA Sp18nnn*n*n Non-specific RCA
  1. Position is according to the full-length HBV genome under GenBank accession number AB241115. Star donated phosphorothioate bonds to resist exonuclease activity of phi29 DNA polymerase. P in superscript indicated the modification of phosphate at the 5′ ends. C28 is the primer to eliminate primer-mediated artifacts from phi29 DNA polymerase-based multiple displacement amplification in our previous study [11]. Sp3, C3 spacer to block self-ligation of the splinter; Sp18, C18 spacer; NA, not applicable. All oligonucleotides were ordered from the Integrated DNA Technologies, Coralville, IA