Skip to main content

TableĀ 1 Primer sequences for PCR and LAMP diagnostic marker sets of MS1 in Cryptomeria japonica

From: Development of diagnostic PCR and LAMP markers for MALE STERILITY 1 (MS1) in Cryptomeria japonica D. Don

Maker ID Primer ID Primer sequencea
(a) ALP_ms1-1 CJt020762_F145 CCATGCCTTTCTTACATGACGAG
CJt020762_R294_A GCCTCCCTCGCGCCATTGATTAATGGGAAAGCCCAGAA
(b) ALP_ms1-2 CJt020762_F1O7.F_A GCCTCCCTCGCGCCACCTCCGGTGTATCAAACTTCAA
CJt020762_F1O7.R ATTCGCCCTTTCCAAATGTTAGC
(c) ALP_ms1 CJt020762_ms1-1_F GCTATAGACTGCACCGACCC
CJt020762_ms1-1_R AGCCCAGAAAATCGTCCCTG
CJt020762_ms1-2_F GAATCCACCGCCACGACTAT
CJt020762_ms1-2_R TGAACTCTGTTTCCATGGCA
(d) ASP_ms1-1 CJt020762_mt-224F_C.f CTGTGACTCACTGGCCACAGTAAC
Cjt020762common.r AGAGAGTGATGGTTTGATTAATGGGAAA
(e) ASP_ms1-1_wt CJt020762_wt-227F_A.f GTGACTCACTGGCCACAGTCATAAA
Cjt020762common.r AGAGAGTGATGGTTTGATTAATGGGAAA
(f) LAMP_ms1-1 4D-1_FIP ACGATGGGGTCGGTGCAGTCTAGCGGTAGCAGAAAGTGTGAT
4D-1_BIP-3C ACGAGATCAGCCAAGCTTTCCAACCCTGCGTGGGTCTG
4D-1_F3 GCGGCAATTGTGAGAGCATT
4D-1_B3 GAAAATCGTCCCTGGAGACG
(g) LAMP_ms1-1_wt MS1-190727_FIP-2A TATTGATGACTGTGGCCAGTGAAGATCAGCCAAGCTTTCCAT
MS1-190727_BIP GGTGCTTGTGCGAGCTCGTCGGAGCGAGAGAGTGATGGTT
MS1-190727_F3 ATCGTGAGCCTCTCACCA
MS1-190727_B3 GGTCAAGTTCACGCGGATA
(h) LAMP_ms1-2 30D-1-FIP-3T TGTAGTGATCCCCAAAATAGCCGTTAGCATTGCTGGAGCC
30D-1-BIP TGAAGTTTGATACACCGGAGGTTTCTGCTAAATATAACTTTGAACTCTG
30D-1-F3 TGATTCGCCCTTTCCAAAT
30D-1-B3 AGACAACAGCAATTCATTCA
  1. aBold and underlined fonts indicate artificial mismatch introduced to increase specificity