Skip to main content

Table 1 Details of the designed primers for the variant CYP2D6*10

From: Design and implementation of a novel pharmacogenetic assay for the identification of the CYP2D6*10 genetic variant

Primers Sequence (5′ to 3′) Length (bp) Product Size (bp) Tm (°C) primer blast result Tm (°C)
CYP2D6*10 (rs1065852 C>T)
CYP2D6*10-CF 5′TGGCAGCACAGTCAACACAGCAGGTTC 3′ 27 Control: 454 (T): 300 (C): 195 69.49 64.9
CYP2D6*10-CR 5′CTGGTCCAGCCTGTGGTTTCACCCAC 3′ 26 69.26 65.2
CYP2D6*10-F(C) 5ʹAACGCTGGGCTGCACGCTCCC 3′ 21 68.11 67.7
CYP2D6*10-R(T) 5′GGCAGTGGCAGGGGGCCTGGGGA 3′ 23 73.83 72.6