Skip to main content

Table 1 Primer sets for determination of perforin CpG methylation by pyrosequencing

From: Determination of quantitative and site-specific DNA methylation of perforinby pyrosequencing

Amplicon*
(bp)
PCR primers (5' to 3') Sequencing primers CpG site # and nucleotide
position
A (236) FW: TTG ATT TTA TAG GTG AGG AAA TTA
RV: TTC CAA CTA TCA CCC ATA ACC TAA
TTT TAT AGG TGA GGA AAT TA
A Y GTTTAGAAAGGGGGTTGATATTTAT Y GT Y GTGAGGTATA Y GG
ATT TTT ATG TTT TTT AAA T
Y GGTTTTTTTGTTA
1, -1365; 2, -1339; 3, -1336; 4, -1325
6, -1231
B (226) FW: ATG TTG AGG TTG TGA GGA GTT TT
RV: AAA TTC CAA AAT CCT CTC TTT AAT
GAA GTT TTG TAA AGT ATT TG
Y GGGAAAAGAG
5, -1267
C (196) FW: TTG GAA AGT GAT TAG GAG GTT GTA
RV: CAA ACT CCA AAC CAC ATA TAA CAT
AGA GGG TGG GGA TATT
G Y GGAGAGAAGATGGGGTTAGATTT Y G
GTT TTT GTT TTT GTA AGA GT
AGGGA Y GGAAGTAGGGATATAAA Y G
7, -1110; 8, -1088
9, -1045; 10, -1027
D (91) FW: GAG GTT TTT ATG GGT GGA GTG AT
RV:CAC CTC CTC CCT TAC CCA ACT A
TTG GGG GGT AAA ATT
ATA Y GGTTTT T
11, -876
E (256) FW: TTT TGA GTG GGA GAA GAG AGA TGT
RV:CCC CAC CCT AAC CTC AAA CA
GTG AGA GTG GTT TGG TAG
TAT Y GGAGG
TTG GTT TTA GTT TTG TTG A
GGT Y GTGGGT
AGG ATA GTT AGT GGT TTT TA
Y GTTGGTTTTAGTTTTGTTG
12, -776
13, -774
14, -720
F (167) FW: TGG AGG TTA TTG GTT GTT TTT ATA
RV: TAA CCA TTC CCT CCT CCC TAA ATA
GGT TAT TGG TTG TTT TTA TA
AAG Y GAGGAG T AGGAGTTTTTGTT Y GAGGAATATGTTTGGAGTT Y GG
15, -691; 16, -670; 17, -650
G (300) FW: TTA GGG AGG AGG GAA TGG TTA TAG
RV: AAC CAA CAA AAC CAT CTC CTT ACT
TAG TTT ATA TTG TTG GTG TA
TAAT Y GAGTTGTTTAAGTTT Y GG Y GGTTTGG Y G
18, -397; 19, -381; 20, -378; 21, -370
H (300) FW: TTT AGG GAG GAG GGA ATG GTT ATA
RV: ACC AAC AAA ACC ATC TCC TTA CTT
TAC TTC TAA TAC ACA ACA TC
R CATATATAAAATATAAAAAACAAACAAAAAC R AC R AC
24, -313; 23, -345; 22, -348
I (233) FW: GGG GAT TTA GGG TAT ATA GG
RV: AAA CCC TAC CAA TCC ACA CTA CT
GGG GAT TTA GGG TAT AT
AGG Y GGAGGAGGG Y GGGG Y GTTGAGGATTTTGAGATT Y GGT
28, -219; 27, -229; 26, -234; 25, -253
J (237) FW: TGG TTT TGT TGG TTT GTT TAT TAA
RV: CCC CAA CTA TAA TCA CAA ATC CTT
CAA AAC CAA AAA CTC ATC T
ACC R AATAAAACTACTAAAACTC R
CCT CAA CCC TCA TCC
R ACTCCCCACTAACAACCCTCAAAAAAC R AAC
30, -180; 29, -200
32, -122; 31, -150
K (97) FW: TTG AGG ATA GGG TGG GTG TT
RV: CCA CCA CTC ACA TCA CTT CTA CTT
GGA TAG GGT GGG TGT T
Y GTGGGAGGGGAGAGTATAAAGGATTTGTGATTATAGTTGGGGG Y
33, -92; 34, -48
  1. *Nucleotide positions of amplicons from 5' → 3' direction of the top or bottom strand used for assay design. A, 20 – 255; B, 1186 – 1411; C, 250 – 445; D, 826 – 916; E, 569 – 824; F, 692 – 858; G, 838 – 1137; H, 837 – 1136; I, 200 – 432; J, 1124 – 1360; K, 1298 – 1394. Amplicons in bold (B, D, E and I) represent those amplicons designed using the bottom strand after bisulfite conversion.
  2. Fw, forward primer; Rv, reverse primer. Biotinylated primers are indicated in bold.
  3. Sequencing primers are indicated in bold. Sequences to analyze are italicized with the CpG sites (Y or R) underlined.
  4. Indicates CpG site number and corresponding nucleotide location from the distal end of the promoter. Numbering is based on the top strand used for assay design.