Emergence of KPC-producing Klebsiella pneumoniae in Italy

Klebsiella pneumoniae carbapenemase (KPC) is a molecular class A serine β-lactamase belonging to functional group 2f [1]. KPC was first reported in 2001 after its discovery in a K. pneumoniae clinical isolate collected in North Carolina during the ICARE (Intensive Care Antimicrobial Resistance Epidemiology) surveillance study [1–3]. The first detection of KPC-2 on a plasmid in P. aeruginosa was reported; this represents a disturbing development in the spread of these carbapenemases [2, 4]. Although the KPC β-lactamases are predominantly found in K. pneumoniae, there have been reports of these enzymes in Enterobacter spp. and in Salmonella spp and in other genera of the Enterobacteriaceae family [5–10].

KPC-positive strains are typically resistant to the penicillins, extended-spectrum cephalosporins, and aztreonam, but the MICs of these drugs and of the carbapenems are reduced in the presence of clavulanic acid due to enzyme inhibition [2]. Isolates that acquire this enzyme are usually resistant to several other classes of antimicrobial agents used as treatment options. Laboratory identification of KPC-producing clinical isolates will be critical for limiting the spread of this resistance mechanism. The failure of automated susceptibility testing systems to detect KPC-mediated resistance was previously noted, particularly if ertapenem, which was determined to be more susceptible to the idrolytic activity of KPC carbanemase, was not tested [11]. After the rapid expansion of the KPC class of carbapenemases along the east coast of the United States, reports from across the world began to appear. A report from France in 2005 documented KPC-2 in a K. pneumoniae strain from a patient who had been in New York for medical treatment [12]. KPC-producing organisms have continued to spread over time and have now been reported in 27 states in the United States and in many countries around the world, including China, Colombia, Brazil, Israel, Canada, France, the Republic of Ireland, Greece (where infection caused by KPC is mainly due to hyperepidemic clone) and more recently in Italy [8–19]. We report, in this paper, the first two cases of KPC2 producing K. pneumoniae in Italy. Our finding confirms that KPC producing isolates are a global concern and that every effort should be made from the laboratory to early identification of these phenotypes.

Isolates were tested for susceptibility using Vitek2 (bioMérieux, Durham, NC), using AST GN13 and AST GN074, as well as the AST N022 card. Susceptibility was also confirmed for meropenem, imipenem, ertapenem, colistin and amikacin using Etest (bioMérieux Italia; Firenze, Italy) according to the manufacturer's recommendations and incubated for 18 hours at 35°C in ambient air. MICs were interpreted according to the Clinical Laboratory Standards Institute (CLSI) guidelines [20]. MIC for colistin were interpreted according to the EUCAST breakpoints available at the web site http://www.srga.org/eucastwt/MICTAB/index.html. Isolates were also tested using the modified Hodge test [21]. To exclude the possibility of a metallo-beta-lactamases (MBL) production a synergy test using imipenem and EDTA discs was used, the test was performed according to CLSI [20, 22]

Analysis of β-lactamase genes (including bla_KPC bla_TEM bla_OXA, and bla_SHV), CTX-M type, VIM type, IMP type as well as bla AmpC were preformed as previously reported [13, 23–26].

Amplified products of the expected size were confirmed as KPC by sequencing. For typing of the bla_KPC gene, overlapping PCR reactions were performed using the following primer pairs: F-5'CGGAACCATTCGCTAAACTC3' and R-3'GGCGGCGTTATCACTGTATT5' primers; F-5'CGCCGTGCAATACAGTGATA3' and R-3'CGTTGACGCCCAATCC5' primers [13].

Amplification products were purified using the Montage PCR Centrifugal Filter Device (Millipore Corporation, Billerica, MA), and sequencing was performed by Big Dye Terminators V1.1 (Applied Biosystems, Foster City, CA) and migrated with an automated sequencer (ABI Prism 310; Applied Biosystems). Sequences were aligned and compared using the National Center for Biotechnology Information database http://www.ncbi.nlm.nih.gov/.

Both patients improved clinically with tigecycline treatment, even if for the second patient a septic event due to P. aeruginosa (successive to K. pneumoniae infections) needed to be treated with meropenem.

This is the second documented appearance of a class A carbapenemase-producing isolate of K. pneumoniae in Italy, harbouring KPC type 2 gene, that was not associated with travel abroad. KPC β-lactamases (KPC 1-7) confer decreased susceptibility or resistance to all β-lactams [14, 27]. The isolate showed reduced susceptibility or resistance to four different antibiotics, limiting the therapeutic options to polymixin, amikacin, and tigecycline [13]. At present, these are the second published cases of KPC-producing K. pneumoniae infections in Italy, after that published by Giani et al [19]. The dissemination of KPC-producing organisms is no longer restricted to the United States and has emerged as a global concern, aided by the recently described mobile genetic element Tn 4401, which carries the KPC genes [28]. Carbapenemase-producing pathogens cause infections that are difficult to treat and have high mortality rates due to their appearance in multidrug-resistant pathogens such as K. pneumoniae, P. aeruginosa, and Acinetobacter spp [2]. The first descriptions of these enzymes as species-specific chromosomal carbapenemases have more recently been followed by the appearance of carbapenemase genes that are easily transferred on mobile elements between species. While considered by some to be relatively rare, reports of their occurrence in outbreak settings have steadily increased [2, 13, 14]. Detecting their entry into the hospital environment is the first step that clinical microbiologists can take to address this problem. Care in detection is needed, because high carbapenem MICs are not always evident and the phenotype could be confused with that described by Cagnacci et al [11, 22, 29]. Therefore, it is essential that the initial complete screening of the isolate includes Hodge's test as well as MBL test. Evaluation of effective antibiotic options and rigorous infection control measures will help in the fight against carbapenemase-producing organisms [2]. Regardless of the geographic location, microbiology laboratories in Italy need to ensure that they have methods in place for the accurate detection of KPC-producing organisms and must constantly be aware of their potential to spread.

Given the impossibility of finding the first patient (lost to follow up) and the death of the second, the ethics committee of the hospital gave approval for anonymous publication of these clinical cases (n 17/08 English version 04/2009).