Skip to main content

Table 1 Primers for RTqPCR used in the present study.

From: Validation of reference genes for quantitative RT-qPCR studies of gene expression in Atlantic cod (Gadus morhua l.) during temperature stress

Gene Accesion # Primer forward Primer reverse E. Amplicon size
rplp1 EX741373 tccaaaccctaaaatccaaca tggaggatcagagcagagtaaa 1,89 77
actb AJ555463 acaccgtgcccatctacg ccaagtccagacggaggat 2,05 60
b2m acc386599 gagcccaacaccctgatct gctcgatggtgatctctgg 2,11 61
ef1a DQ402371 caggtcatcatcctgaacca atccaggactggggcatag 2,02 60
g6pd EX741924 acactctgcaccagggagtc ccactgctgcaccacatc 1,88 98
tba1c EL616694 ctccaccaggaactacagtgg tagactggtgcccaactggt 2,10 69
ubiq EX735613 cattgagccttccctcagaa ttgcggcagatcatcttgt 1,98 63
18s AJ427629 tgtgccgctagaggtgaaatt gcaaatgctttcgctttcg 2,03 61
hsp70 ES478099 ggagttcaagcggaagttca agcctcctcaaagccctct 1,87 60
hsp90 ES783928 tcctccgatactacacctcca gcgagacacgtagtccttga 1,98 65
  1. Reference and hsp's gene primer sequences, amplicon sizes, amplification efficiency values and accession # for the PCR analyses in the present study.