Skip to content

Advertisement

  • Erratum
  • Open Access

Erratum to: Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua

BMC Research Notes20114:456

https://doi.org/10.1186/1756-0500-4-456

  • Received: 24 October 2011
  • Accepted: 27 October 2011
  • Published:

The original article was published in BMC Research Notes 2008 1:47

Following the publication of our article[1], an error in Table 2 was noted, the wrong accession number and primer sequences were stated for the EF1A assay.

The GenBank accession number was incorrectly stated as:

EX721840

Forward primer: CCCTGTGGAAGTGGCTGAAG

Reverse primer: CATCCAAGGGTCCGTATCTCTT

The correct GenBank accession number should be:

EX722124 Forward primer: CGGTATCCTCAAGCCCAACA Reverse primer: GTCAGAGACTCGTGGTGCATCT

We apologise for any inconvenience this may have caused.

Notes

Authors’ Affiliations

(1)
National Institute of Nutrition and Seafood Research, Nordnesboder 2, N-5005 Bergen, Norway

References

  1. Olsvik PA, Softeland L, Lie KK: Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua. BMC Research Notes. 2008, 1: 47-10.1186/1756-0500-1-47.PubMedPubMed CentralView ArticleGoogle Scholar

Copyright

Advertisement