Skip to main content

Advertisement

You are viewing the new article page. Let us know what you think. Return to old version

Erratum to: Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua

The original article was published in BMC Research Notes 2008 1:47

Following the publication of our article[1], an error in Table 2 was noted, the wrong accession number and primer sequences were stated for the EF1A assay.

The GenBank accession number was incorrectly stated as:

EX721840

Forward primer: CCCTGTGGAAGTGGCTGAAG

Reverse primer: CATCCAAGGGTCCGTATCTCTT

The correct GenBank accession number should be:

EX722124 Forward primer: CGGTATCCTCAAGCCCAACA Reverse primer: GTCAGAGACTCGTGGTGCATCT

We apologise for any inconvenience this may have caused.

References

  1. 1.

    Olsvik PA, Softeland L, Lie KK: Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua. BMC Research Notes. 2008, 1: 47-10.1186/1756-0500-1-47.

Download references

Author information

Correspondence to Pal A Olsvik.

Additional information

The online version of the original article can be found at 10.1186/1756-0500-1-47

Rights and permissions

Reprints and Permissions

About this article