Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Research Notes

Open Access

Clinical utility of RD1, RD9 and hsp65 based PCR assay for the identification of BCG in vaccinated children

  • Jeanette WP Teo1Email author,
  • Janet WS Cheng1,
  • Roland Jureen1 and
  • Raymond TP Lin1
BMC Research Notes20136:434

https://doi.org/10.1186/1756-0500-6-434

Received: 9 July 2013

Accepted: 23 October 2013

Published: 29 October 2013

Abstract

Background

Mycobacterium bovis Bacille Calmette-Guérin (BCG) vaccine is widely administered to prevent tuberculosis. Vaccine complications are rare. However, when BCG-related adverse reactions arise there is a need to rapidly and reliably identify BCG from other members of the Mycobacterium tuberculosis complex (TBC). PCR assays based on the detection of the regions of difference (RD), in particular RD1 and RD9, have been invaluable in the identification of BCG. Prior to this study, specimens were identified through HPLC analysis at a local reference laboratory taking up to 2 weeks for a result. We sought to expedite the identification process by validating a RD1, RD9 and hsp65 PCR assay for the identification and differentiation of BCG from TBC.

Findings

In last past 3 years, we validated the RD1, RD9 and hsp65 PCR assay for 16 mycobacterial isolates obtained from children who had experienced adverse reactions to BCG vaccination. In these cases, the clinician required a definitive identification of the isolate. The RD1 and RD9 PCR profiles indicated that all 16 isolates were BCG whilst amplification of the hsp65 target functioned as a PCR positive control. When tested against clinical M. tuberculosis (MTB), reference and non-tuberculous mycobacteria the PCR assay demonstrated 100% sensitivity and specificity.

Conclusions

The RD1, RD9 and hsp65 PCR assay is a useful tool for the rapid and reliable identification of BCG. Its ease of use has allowed it to be implemented in our clinical microbiology laboratory.

Keywords

Mycobacterium bovis Bacille Calmette-Guérin (BCG)Adverse reactionPCR

Findings

Mycobacterium bovis Bacille Calmette-Guérin (BCG) vaccine has been used extensively for almost the last 100 years for the prevention of TB. In countries with a national childhood immunization programme, vaccination rates typically exceed >80% in neonates and infants[1]. In Singapore, BCG vaccination is given to all newborns since 1957 and has contributed to an effective TB Control Programme.

The BCG vaccine is regarded as safe. There is a very low incidence of complications, ranging from 0.1 to 5 per 1000 vaccinated[2, 3]. BCG-induced adverse events can be broadly classified into local or disseminated disease ranging from sub-cutaneous abscess and keloids, lymphadenopathy, suppurative lymphadenitis to systemic events such as osteitis and disseminated BCG disease[3, 4]. The risk of disseminated BCG disease escalates in HIV-infected children[5]. Chemotherapy with anti-tuberculosis drugs may be initiated to prevent further progression to disseminated disease however treatment is complicated by the inherent resistance of all M. bovis strains to pyrazinamide[5, 6]. Therefore, it is imperative to accurately identify and differentiate M. bovis BCG particularly from M. tuberculosis.

The diagnostics of BCG is not straightforward. M. bovis BCG belongs to the Mycobacterium tuberculosis complex (TBC) of highly related organisms comprising M. tuberculosis, M. africanum, M. bovis, M. microti and M. canetii. The lack of clear-cut differentiation between the members[7] impedes the identification of BCG. Limited methods avail for the differentiation of members of the TBC. Phenotypic biochemical assays can be highly subjective making it unreliable for identification[8]. High performance liquid chromatography (HPLC) analysis can separate BCG vaccine strains from M. tuberculosis and M. bovis[9]. However, this approach is not pragmatic for the routine diagnostic laboratory due to requirement of specialized equipment and protracted turnaround times.

Comparative genomics has revealed 16 regions of difference (RD) in M. bovis and M. bovis BCG strains, which are absent in M. tuberculosis H37Rv. Regions RD1, RD9, RD10 have been extensively studied. Their exclusive absence in all BCG vaccine strains and presence in TB strains makes these loci reliable and accurate diagnostic markers[10, 11]. Deletion profiles based on these RD regions have been employed successfully for the differentiation of BCG and TB via PCR based approaches[1214].

This study was initiated three years ago, in 2010, when we sought to evaluate a PCR approach for the rapid identification of BCG that would be suitable for implementation in our routine diagnostic microbiology laboratory. Prior to this, specimens were identified through HPLC analysis at a local reference laboratory. Here, we describe the clinical performance of the PCR assay based on the detection of RD1 and RD9 regions for the identification and differentiation of BCG from MTB.

Bacterial isolates used in the study comprised reference strains and clinical isolates (Table 1). Reference mycobacterial isolates were from the American Type Culture Collection (ATCC, Manassas, VA, USA) and non-mycobacterial quality control strains Rhodococcus equi and Norcardia farcinica were from our laboratory. Clinical mycobacterial specimens were obtained from (i) patients deemed to have adverse reactions to BCG immunization hence requiring definitive identification of the mycobacterial isolate (n=16), (ii) patients with confirmed TB (n=32). The diagnosis of tuberculosis was based on clinical and microbiological findings whereby the cultures were positive for M. tuberculosis by the Xpert MTB/RIF real-time PCR assay (Cepheid, Sunnyvale, CA)[15]. The isolation of clinical mycobacterial isolates from patient specimens is described below. Ethical approval was not required as the study was conducted for the improvement of a public health service and in a manner that subjects could not be identified.
Table 1

Characteristics of specimens sent for BCG identification, clinical MTB isolates and reference strains

Samples

Disease description and management

Specimen site

PCR

result

PCR

oxyR *

SD TB Ag MPT64 Rapid test

AccuProbe Complex test

 

RD1

RD9

hsp65

 

For BCG identification ( n =16)

Case/Sex/Age (months)

1/M/3

BCG adentitis. Excision of inguinal lymph node

Inguinal lymph node

+

M. bovis

NEG

ND

2/M/2

Incision and drainage of abscess

Axillary abscess

+

M. bovis

NEG

POS

3/M/2

No information available

Axillary abscess

+

M. bovis

NEG

POS

4/F/4

Incision and drainage of gluteal abscess

Injection site abscess

+

M. bovis

NEG

POS

5/M/3

BCG adentitis. Excision of inguinal lymph node

Inguinal lymph node

+

M. bovis

NEG

POS

6/F/3

No information available

Inguinal lymph node

+

M. bovis

NEG

POS

7/M/3

No information available

Inguinal lymph node

+

M. bovis

NEG

POS

8/F/3

No information available

Inguinal lymph node

+

M. bovis

NEG

POS

9/M/4

BCG adenitis. Excision of inguinal lymph node

Injection site abscess

+

M. bovis

NEG

POS

10/M/22

No information available

Lymph node

+

M. bovis

NEG

POS

11/M/2

No information available

Lymph node

+

M. bovis

NEG

POS

12/F/3

Left caseating inguinal lymph node.

Lymph node

+

M. bovis

NEG

POS

13/M/3

No information available

Inguinal lymph node

+

M. bovis

NEG

POS

14/M/4

Left axillary lymph node abscess. Incision and drainage

Axillary abscess

+

M. bovis

NEG

POS

15/M/3

No information available

Lymph node abscess

+

M. bovis

NEG

POS

16/M/3

No information available

Inguinal lymph node aspirate

+

M. bovis

NEG

POS

For specificity and sensitivity testing

Clinical MTB isolates (n= 32)

 

Respiratory and non-respiratory

+

+

+

ND

POS

POS

M. tuberculosis complex control strains (n=3)

       

M. bovis BCG Pasteur ATCC 35734

NA

+

M. bovis

NEG

POS

M. tuberculosis H37Ra ATCC 25177

NA

+

+

+

MTB

POS

POS

M. tuberculosis H37Rv ATCC 27294

NA

+

+

+

MTB

POS

POS

 Non M. tuberculosis strains (n=13)

       

M. intracellulare ATCC 13950

NA

ND

ND-

ND

M. gordonae ATCC 35756

NA

ND

ND

ND

M. kansasii ATCC12478

NA

ND

ND

ND

M. septicum ATCC 700731

NA

ND

ND

ND

M. senegalense ATCC 35755

NA

ND

ND

ND

M. perigrinum ATCC 23001

NA

ND

ND

ND

M. xenopi ATCC 19250

NA

ND

ND

ND

M. abscessus ATCC 19977

NA

ND

ND

ND

M. chelonae ATCC 19539

NA

ND

ND

ND

M. fortuitum ATCC 6841

NA

ND

ND

ND

M. haemophilum ATCC 29548

NA

ND

ND

ND

Rhodococcus equi

NA

ND

ND

ND

Norcardia farcinica

NA

ND

ND

ND

ND: Not done.

NA: Not applicable.

— : No PCR amplification observed.

+ : Positive PCR amplification.

oxyR: A single nucleotide polymorphism, G➔A at position 285, revealed by oxyR sequencing differentiates M. bovis and TBC.

Respiratory and non-respiratory specimens (including pus and aspirate samples) were decontaminated according to standard methods using N-acetyl-L-cysteine–sodium hydroxide (NALC-NaOH)[16]. Tissue specimens were thoroughly minced using a pair of sterile scissors before the NALC-NaOH processing. Sediment from the specimen obtained by centrifugation at 3600 rpm for 15 min was resuspended in phosphate-buffered saline pH 6.8 to a final volume of 1.5 ml. Half of the sediment was used for inoculation into the automated Mycobacteria Growth Indicator Tube [MGIT, (Becton Dickinson,Cockeysville, MD)] culture system and the other half was inoculated into a Lowenstein-Jensen (LJ) slant. Cultures were incubated at 37°C for 6 weeks in MGIT and 8 weeks on LJ slants at 37°C and 5% CO2. Prior to transporting the pure mycobacterial cultures out of the Biosafety Level 3 Laboratory, the bacteria were killed by resuspending colonies in 500 μl of sterile water and boiled in screw cap tubes for 10 min.

The detection of two regions of difference (RD1 and RD9) was the basis of the PCR assay used to identify and differentiate BCG from TBC[13] (Table 2). The DNA template used for the PCR was 2 μl of boiled culture supernatant (above). For each isolate tested, three sets of PCR reactions were setup enabling the detection of RD1, RD9 and hsp65 (Table 2). The amplification of a 401 bp fragment from hsp65 served as a PCR positive control for members of the MTB complex. PCR amplification reactions were performed using HotStarTaq master mix kit (Qiagen, Hilden, Germany) with an initial denaturation at 95°C for 5 min, followed by 35 temperature cycles of heat denaturation at 94°C for 30 s, primer annealing at 62°C for 90 s and extension at 72°C for 60 s and a final step of extension at 72°C for 10 min. PCR products were separated by electrophoresis in 1.5% agarose gel, stained with ethidium bromide and visualized by UV transillumination. The results were positive when the specific size product was observed (Table 2).
Table 2

PCR primers used in this study

Primer pair

Sequence 5’- 3’

Target locus

Amplicon size (bp)

Reference

RD1 For

CCGTTGGCAGCATTGGCGGCG

RD1

126

This study

RD1 Rev

CCGGGCCCAGGAATATAGCCAG

RD9 FF

GTGTAGGTCAGCCCCATCC

RD9

333

[13]

RD9 Int

CAATGTTTGTTGCGCTGC

mycHsp65 left

CCGAGCTGGTCAAAGAGGTA

hsp65

401

This study

mycHsp65 right

CACGAAGTACCCCGAGATGT

oxyR For

GGTGATATATCACACCATA

oxyR

548

[17]

oxyR Rev

CTATGCGATCAGGCGTACTTG

Additional tests used for the identification of members of TBC include (i) AccuProbe Mycobacterium Tuberculosis Complex Culture Identification Test (Gen-Probe Incorporated, San Diego, CA) is a rapid DNA probe test utilizing nucleic acid hybridization for the identification of TBC isolated from culture. Testing was performed in accordance with the manufacturer's instructions. Briefly, after bacterial lysis, a 100 μl sample was transferred to the corresponding AccuProbe tube. Hybridization results, expressed as relative light units (RLUs), were determined with a Leader 50 luminometer (GenProbe). A positive reaction was a result > 30 000 RLU. (ii) SD TB Ag MPT64 Rapid (Standard Diagnostics, Seoul, South Korea) is an immunochromatographic test using anti-MPT64 antibodies for the detection of the MPT64 antigen of MTB isolates. The assay is used primarily to distinguish between M. tuberculosis complex and non-tuberculous mycobacteria (NTM). The kit was used according to the manufacturer's protocol. Briefly, 100 μl of condensation fluid from colonies growing in LJ slants were applied directly to the sample well. Tests were interpreted 15 min after sample application. The presence of only a control band alone indicated a negative result whereas the appearance of a second band (test band) indicated a positive result for MTB. (iii) oxyR sequencing. A single nucleotide polymorphism in position 285 of the oxyR sequence allows differentiation of M. bovis from the other members of the TBC. All M. bovis strains have an adenine (A) residue at nucleotide 285, whereas all M. tuberculosis strains have guanine (G) residue at this position[14, 17]. A 548 bp fragment of oxyR was amplified using the primer set listed in Table 2. The PCR conditions used were based on a published PCR protocol[17]. The amplicon was purified using QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and sequenced using the same set of primers.

The administration of the BCG vaccine rarely causes complications. Mild injection site reactions are almost universal upon vaccination, often taking the form of a papule or scarring. Typically no treatment is required. Severe local and systemic BCG-induced disease is a much less frequent occurrence and may necessitate the initiation of treatment with anti-tuberculosis drugs[3, 4]. Hence, it is critical to have rapid and accurate tests that can detect M. bovis BCG and differentiate it from MTC so that the clinician can choose the appropriate treatment.

Over the last 3 years, there were 16 cases submitted to our laboratory requesting the differentiation of BCG from MTB. BCG induced disease was suspected as adverse reactions arose shortly after vaccination and in close proximity to the injection site. Clinical descriptions of the cases where available are indicated on Table 1. In all cases with surgical intervention, the patients healed well.

Molecular assays based on the RD deletion profiles have been invaluable in differentiating members of the TBC[1214]. The complete absence of both RD1 and RD9 is indicative of M. bovis BCG, conversely the presence of both RD1 and RD9 indicates M. tuberculosis. Non-BCG M. bovis is distinguished from BCG by the presence of RD1 and the absence of RD9[1214]. In this study, none of the 16 isolates submitted for testing were positive for RD1 or RD9, indicating they were M. bovis BCG. These PCR results confirmed suspicions of BCG-related disease in the recently vaccinated children (Table 1). The RD1 and RD9 PCR assay was also evaluated using clinical TB isolates (n=32), ATCC isolates of MTB and M. bovis BCG Pasteur as well as NTMs and was determined to have 100% specificity and sensitivity (Table 1). The PCR assay includes a positive amplification control designed specifically to detect the hsp65 gene from TBC members. Performance of the hsp65 PCR control was also excellent, exhibiting 100% specificity and sensitivity (Table 1).

oxyR sequencing of the 16 isolates from suspected BCG cases displayed the distinctive single nucleotide polymorphism of M. bovis isolates with G➔A at position 285[17] (Table 1). The oxyR polymorphism however does not make a distinction between BCG and non-BCG M. bovis. Based on patient clinical history and the fact that zoonotic M. bovis infections would be almost non-existent in a non-cattle farming setting such as ours[18], M. bovis BCG would be the presumptive identification.

Distinguishing BCG from M. bovis is not a simple task. Phenotypically both species are susceptible to thiophene-2-carboxylic acid hydrazide and resistant to pyrazinamide although M. bovis has a preference for microaerophilic conditions compared to BCG which displays aerophilic growth (13). HPLC analysis of mycolic acid esters can be used for confirmation of BCG strains as it possesses a profile that is unique from M. bovis however it is a method that is restricted to being carried out at a mycobacterial reference laboratory (9). Comparatively, molecular testing offers accessibility and rapidity. Apart from the exploitation of RD profiles for species differentiation, the size-variable senX3-regX3 intergenic region has also been targeted[19]. PCR assays that utilize the senX3-regX3 intergenic region are also typically used in conjunction with the RD targets thereby underscoring the importance of RD for differentiating TBC members[20].

Other tests routinely performed in our laboratory for the identification of members of the TBC include the AccuProbe Mycobacterium tuberculosis complex test and the SD TB Ag MPT64 Rapid test. The AccuProbe Mycobacterium tuberculosis complex test is used for the identification of TBC members and as anticipated it did not differentiate between BCG and TB. All the BCG cases as well as the clinical TB cases tested positive with this kit (Table 1). The SD TB Ag MPT64 Rapid is an immunochromatographic test detecting MPT64, an antigen secreted by members of the TBC. Most BCG vaccine strains do not secrete MPT64 nevertheless exceptions have been noted[21, 22]. Strains like BCG Tokyo and BCG Russia still retain the gene for MPT64 and the capacity to secrete the antigen[21, 23]. These vaccines strains could still test positive on the SD TB Ag MPT64 Rapid test. All our MTB isolates gave positive results with the SD TB Ag MPT64 Rapid test. In contrast, all the BCG suspected cases tested negative (Table 1). In Singapore, since June 2003, BCG Danish strain 1331 has been the sole vaccine type[24]. This strain lacks MPT64[23] and will therefore be negative on the SD TB Ag MPT64 Rapid test.

Prior to establishment of the PCR assay, specimens for BCG confirmation were sent to a reference laboratory for HPLC analysis. Here, we present evaluation data demonstrating the clinical validity of the RD1, RD9 and hsp65 based PCR assay for the rapid detection and differentiation of M. bovis BCG. Its reliability and ease of use has made it feasible for incorporation as a routine mycobacterial diagnostic service in our laboratory.

This work was supported by a Health Service Development Programme Grant provided by the Ministry of Health, Singapore (Grant # HSDP06/X04).

Declarations

Authors’ Affiliations

(1)
Department of Laboratory Medicine, Microbiology Unit, National University Hospital

References

  1. World health organization (WHO): Global tuberculosis report. 2012,http://www.who.int/tb/publications/global_report/gtbr12_main.pdf,Google Scholar
  2. Lotte A, Wasz-Hockert O, Poisson N, Engbaek H, Landmann H, Quast U, Andrasofszky B, Lugosi L, Vadasz I, Mihailescu P: Review Second IUATLD study on complications induced by intradermal BCG-vaccination. Bull Int Union Tuberc Lung Dis. 1988, 63 (2): 47-59.PubMedGoogle Scholar
  3. World Health Organization (WHO): Information sheet – Observed rate of vaccine reactions Bacille Calmette- Guérin (BCG) vaccine. 2012,http://www.who.int/vaccine_safety/initiative/tools/BCG_Vaccine_rates_information_sheet.pdf,Google Scholar
  4. Murphy D, Corner LA, Gormley E: Adverse reactions to Mycobacterium bovis bacille Calmette-Guérin (BCG) vaccination against tuberculosis in humans, veterinary animals and wildlife species. Tuberculosis (Edinb). 2008, 88 (4): 344-357. 10.1016/j.tube.2007.11.010.View ArticleGoogle Scholar
  5. Hesseling AC, Schaaf HS, Victor T, Beyers N, Marais BJ, Cotton MF, Wiid I, Gie RP, van Helden P, Warren RM: Resistant Mycobacterium bovis Bacillus calmette-Guérin disease: implications for management of Bacillus Calmette-Guérin Disease in human immunodeficiency virus-infected children. Pediatr Infect Dis J. 2004, 23 (5): 476-479. 10.1097/01.inf.0000126593.21006.ac.PubMedView ArticleGoogle Scholar
  6. Cuello-García CA, Pérez-Gaxiola G, Jiménez Gutiérrez C: Treating BCG-induced disease in children. Cochrane Database Syst Rev. 2013, 1: Article No. CD008300Google Scholar
  7. Tsukamura M, Mizuno S, Toyama H: Taxonomic studies on the Mycobacterium tuberculosis series. Microbiol Immunol. 1985, 29 (4): 285-299.PubMedView ArticleGoogle Scholar
  8. Kent PT, Kubica GP: Public health mycobacteriology : a guide for the level III laboratory. 1985, Atlanta, Ga: Centers for Disease Control, Public Health Service, U.S. Dept. of Health and Human ServicesGoogle Scholar
  9. Floyd MM, Silcox VA, Jones WD, Butler WR, Kilburn JO: Separation of Mycobacterium bovis BCG from Mycobacterium tuberculosis and Mycobacterium bovis by using high-performance liquid chromatography of mycolic acids. J Clin Microbiol. 1992, 30 (5): 1327-1330.PubMedPubMed CentralGoogle Scholar
  10. Brosch R, Gordon SV, Marmiesse M, Brodin P, Buchrieser C, Eiglmeier K, Garnier T, Gutierrez C, Hewinson G, Kremer K, Parsons LM, Pym AS, Samper S, van Soolingen D, Cole ST: A new evolutionary scenario for the Mycobacterium tuberculosis complex. Proc Natl Acad Sci U S A. 2002, 99 (6): 3684-3689. 10.1073/pnas.052548299.PubMedPubMed CentralView ArticleGoogle Scholar
  11. Behr MA, Wilson MA, Gill WP, Salamon H, Schoolnik GK, Rane S, Small PM: Comparative genomics of BCG vaccines by whole-genome DNA microarray. Science. 1999, 284 (5419): 1520-1523. 10.1126/science.284.5419.1520.PubMedView ArticleGoogle Scholar
  12. Talbot EA, Williams DL, Frothingham R: PCR identification of Mycobacterium bovis BCG. J Clin Microbiol. 1997, 35 (3): 566-569.PubMedPubMed CentralGoogle Scholar
  13. Parsons LM, Brosch R, Cole ST, Somoskövi A, Loder A, Bretzel G, Van Soolingen D, Hale YM, Salfinger M: Rapid and simple approach for identification of Mycobacterium tuberculosis complex isolates by PCR-based genomic deletion analysis. J Clin Microbiol. 2002, 40 (7): 2339-2345. 10.1128/JCM.40.7.2339-2345.2002.PubMedPubMed CentralView ArticleGoogle Scholar
  14. Huard RC, Lazzarini LC, Butler WR, van Soolingen D, Ho JL: PCR-based method to differentiate the subspecies of the Mycobacterium tuberculosis complex on the basis of genomic deletions. J Clin Microbiol. 2003, 41 (4): 1637-1650. 10.1128/JCM.41.4.1637-1650.2003.PubMedPubMed CentralView ArticleGoogle Scholar
  15. Teo J, Jureen R, Chiang D, Chan D, Lin R: Comparison of two nucleic acid amplification assays, the Xpert MTB/RIF assay and the amplified Mycobacterium Tuberculosis Direct assay, for detection of Mycobacterium tuberculosis in respiratory and nonrespiratory specimens. J Clin Microbiol. 2011, 49 (10): 3659-3662. 10.1128/JCM.00211-11.PubMedPubMed CentralView ArticleGoogle Scholar
  16. Metchock B, Nolte F, Wallace R: Mycobacterium. Manual of clinical microbiology. Edited by: Murray PR, Baron EJ, Jorgensen JH, Landry ML, Pfaller MA. 2007, Washington, DC: ASM PressGoogle Scholar
  17. Sreevatsan S, Escalante P, Pan X, Gillies DA, Siddiqui S, Khalaf CN, Kreiswirth BN, Bifani P, Adams LG, Ficht T, Perumaalla VS, Cave MD, van Embden JD, Musser JM: Identification of a polymorphic nucleotide in oxyR specific for Mycobacterium bovis. J Clin Microbiol. 1996, 34 (8): 2007-2010.PubMedPubMed CentralGoogle Scholar
  18. LoBue PA, Enarson DA, Thoen CO: Tuberculosis in humans and animals: an overview. Int J Tuberc Lung Dis. 2010, 14 (9): 1075-1078.PubMedGoogle Scholar
  19. Magdalena J, Supply P, Locht C: Specific differentiation between Mycobacterium bovis BCG and virulent strains of the Mycobacterium tuberculosis complex. J Clin Microbiol. 1998, 36 (9): 2471-2476.PubMedPubMed CentralGoogle Scholar
  20. Bedwell J, Kairo SK, Behr MA, Bygraves JA: Identification of substrains of BCG vaccine using multiplex PCR. Vaccine. 2001, 19 (15–16): 2146-2151.PubMedView ArticleGoogle Scholar
  21. Li H, Ulstrup JC, Jonassen TO, Melby K, Nagai S, Harboe M: Evidence for absence of the MPB64 gene in some substrains of Mycobacterium bovis BCG. Infect Immun. 1993, 61 (5): 1730-1734.PubMedPubMed CentralGoogle Scholar
  22. Hasegawa N, Miura T, Ishii K, Yamaguchi K, Lindner TH, Merritt S, Matthews JD, Siddiqi SH: New simple and rapid test for culture confirmation of Mycobacterium tuberculosis complex: a multicenter study. J Clin Microbiol. 2002, 40 (3): 908-912. 10.1128/JCM.40.3.908-912.2002.PubMedPubMed CentralView ArticleGoogle Scholar
  23. Behr MA: BCG–different strains, different vaccines?. Lancet Infect Dis. 2002, 2 (2): 86-92. 10.1016/S1473-3099(02)00182-2.PubMedView ArticleGoogle Scholar
  24. Health Science Authority: Singapore. Product safety alerts. 2011,http://www.hsa.gov.sg/publish/hsaportal/en/health_products_regulation/safety_information/product_safety_alerts/safety_alerts_2011/reports_of_lymphadenitis.html, :Reports of lymphadenitis following administration of BCG Vaccine SSI®,Google Scholar

Copyright

© Teo et al.; licensee BioMed Central Ltd. 2013

This article is published under license to BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement