Skip to main content

Table 2 Primers used in this study

From: The lactic acid bacteria metabolite phenyllactic acid inhibits both radial growth and sporulation of filamentous fungi

Primer name Sequence 5′– 3′ Purpose/accession number
T18r TTTTTTTTTTTTTTTTTTVN cDNA synthesis
actF TCGTGACCTGACGGATTACCTC qPCR actin
actR TGGAAGAAGGAGCAAGAGCAGTG ANI_1_106134
treBF TGGACACTTACCTCTGGGATGAAG qPCR treB
treBR GCTGATGGGCATTGAGTATTTCC ANI_1_1258014
tppAF TTGAAGACACCGTTGGGAAGAG qPCR tppA
tppAR GGAGCAAAAGATGAACTCAGGAGC ANI_1_1432094
phiAF AGTTCGGTGGAAAGGACCTG qPCR phiA
phiAR ATACCCTCACAGCCCTCGTTGTAG ANI_1_280124
brlAF TGGGCAATGTGATACCTTG qPCR brlA
brlAR AATGAGCAGGAACGCACTGGAG ANI_1_2984014
vosAF TACGGAATCCCATCCTCCAC qPCR vosA
vosAR GTCTGGTATTGCGAACGAG ANI_1_952184