Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Research Notes

Open Access

Development and characterization of 16 polymorphic microsatellite markers from Taiwan cow-tail fir, Keteleeria davidiana var. formosana (Pinaceae) and cross-species amplification in other Keteleeria taxa

  • Chin-Shang Ho1,
  • Huei-Chuan Shih2,
  • Ho-Yih Liu3,
  • Shau-Ting Chiu4,
  • Mei-Hui Chen5,
  • Li-Ping Ju6,
  • Ya-Zhu Ko3,
  • Yu-Shen Shih7,
  • Chaur-Tzuhn Chen8,
  • Tsai-Wen Hsu9Email author and
  • Yu-Chung Chiang3Email author
BMC Research Notes20147:255

https://doi.org/10.1186/1756-0500-7-255

Received: 13 February 2014

Accepted: 16 April 2014

Published: 23 April 2014

Abstract

Background

Keteleeria davidiana var. formosana (Pinaceae), Taiwan cow-tail fir, is an endangered species listed on the IUCN Red List of Threatened Species and only two populations remain, both on the Taiwan Island. Sixteen polymorphic microsatellite loci were developed in an endangered and endemic gymnosperm species, Keteleeria davidiana var. formosana, and were tested in an additional 6 taxa, K. davidiana var. calcarea, K. davidiana var. chienpeii, K. evelyniana, K. fortunei, K. fortunei var. cyclolepis, and K. pubescens, to evaluate the genetic variation available for conservation management and to reconstruct the phylogeographic patterns of this ancient lineage.

Findings

Polymorphic primer sets were developed from K. davidiana var. formosana using the modified AFLP and magnetic bead enrichment method. The number of alleles ranged from 3 to 16, with the observed heterozygosity ranging from 0.28 to 1.00. All of the loci were found to be interspecifically amplifiable.

Conclusions

These polymorphic and transferable loci will be potentially useful for future studies that will focus on identifying distinct evolutionary units within species and establishing the phylogeographic patterns and the process of speciation among closely related species.

Keywords

Keteleeria ConservationMicrosatellitesSimple sequence repeat markersPinaceae

Findings

Background

For conservation management, the evaluation of genetic diversity and the identification of distinct evolutionary units in endangered taxa should allow for the development of more efficient conservation strategies[13]. Over the past century, human activities associated with the lumber industry and agriculture have destroyed and fragmented forest habitats at altitudes of 500–2500 m on Taiwan Island. Several gymnosperm species have decreased in population size and are now under threat, including Cycas taitungensis[46], Podocarpus nakaii[1], Amentotaxus formosana[2], and Keteleeria davidiana var. formosana[7]. Extreme population declines can affect the genetic diversity of a species[8]. The loss of genetic diversity carries serious evolutionary concerns regarding both the ability to adapt to changes on oceanic islands and longer-term interactions with other organisms[9]. Thus, molecular markers are used to evaluate endangered species in greater depth, with the purpose of applying this genetic diversity information to the conservation and restoration of biodiversity[10].

Keteleeria davidiana var. formosana (Pinaceae), Taiwan cow-tail fir, is an endangered species listed on the IUCN Red List of Threatened Species[11] and derived from K. davidiana, including var. davidiana and var. calcarea, occurred in China by geographical disjunction and leaf scars obscurely or obviously protruding on branchlets[12]. The taxa has only two wild populations, the Dawu Taiwan Keteleeria Forest Reserve (Dawu) and the Pinglin Taiwan Keteleeria Nature Reserve (Pinglin), which are located in Northern and Southern Taiwan, respectively[13]. A previous inventory study has found that less than a hundred individuals remain in the wild, few seedlings are found in the field, and adult trees are vulnerable to lightning damage or death[14]. Additionally, continuous logging over the past century in the low-elevation broadleaf forests has restricted K. davidiana var. formosana to narrow habitats and has decreased its population size[15]. Therefore, the conservation strategies for Keteleeria davidiana var. formosana should include in situ protection and management in conjunction with ex situ approaches such as clonal orchards. Hence, the population genetics of this species should be evaluated before in situ and ex situ conservation management begins. In this study, we developed polymorphic microsatellite loci from Taiwan cow-tail fir to estimate the population structure within the species and to identify distinct evolutionary units within the population. In addition, the transferability of the microsatellite primers developed in this study was tested in other taxa, specifically, three species and three varieties of the Keteleeria genus.

Methods

Sampling and DNA extractions

Twenty-five individuals were sampled from each of the two remaining populations of K. davidiana var. formosana from Dawu and Pinglin, Taiwan (Table 1). To test the transferability of the markers, two to three individuals of three species, K. pubescen s, K. fortune, and K. evelyniana, and three varieties, K. fortunei var. cyclolepis, var. calcarea, and K. davidiana var. chienpeii, were sampled from the field. Permission for tissue collection was obtained from the Council of Agriculture, Republic of China, authorities. All taxa of the Keteleeria genus are diploid with 24 chromosomes[13]. The sample size, location, and storage herbarium for the voucher specimens are listed in Table 1. Total genomic DNA was extracted from silica-dried leaf powder using the Plant Genomic DNA Extraction Kit (RBC Bioscience, Taipei, Taiwan).
Table 1

Sample location for each species, variety, and population of the Keteleeria species

Species

Location

Sample size

Latitude

Longitude

Herbarium

K. davidiana var. formosana

Pinglin, Taiwan

25

N 24°53′28″

E 121°42′12″

TAIF

 

Dawu, Taiwan

25

N 22°21′23″

E 120°47′27″

TAIF

K. fortunei var. cyclolepis

Fujian, China

3

N 27°09′18″

E 118°13′03″

TAIF

K. pubescens

Guizhou, China

3

N 26°30′54″

E 108°03′52″

TAIE

K. davidiana var. calcarea

Guangxi, China

3

N 25°12′47″

E 110°11′50″

TAIE

K. davidiana var. chienpeii

Guizhou, China

3

N 26°20′26″

E 106°41″52″

TAIE

K. fortunei

Fujian, China

3

N 26°09′57″

E 119°02′19″

TAIF

K. evelyniana

Yunnan, China

3

N 23°42′55″

E 105°07′24″

TAIE

Sample size, location, coordinates, and voucher specimens are indicated.

Note: TAIF = the herbarium of the Taiwan Forestry Research Institute; TAIE = the herbarium of the Taiwan Endemic Species Research Institute.

Isolation of microsatellite DNA loci and identification

To isolate the microsatellites efficiently, we used the modified AFLP[16] and magnetic bead enrichment method[1, 17, 18] to select microsatellite loci. Genomic DNA from one individual of K. davidiana var. formosana was treated with the restriction enzyme Mse I (Promega, Madison, Wisconsin, USA) and separated using 1% Nusieve® 3:1 agarose gel (FMC Bio Products, Rockland, ME, USA) electrophoresis. The cut DNA fragments ranged from 400 to 1000 bps, and the purified fragments were extracted from the agarose gel using the HiYield™ Gel PCR DNA Fragments Extraction Kit (RBC Bioscience). Purified DNA fragments were ligated to a double-stranded Mse I-adaptor (complementary oligo A: 5′-TACTCAGGACTCAT-3′; 5′phosphorylated oligo B: 5′-GACGATGAGTCCTGAG-3′) using the Quick Ligation™ Kit (New England Biolabs, MA, USA) at 25°C for 5 minutes. The ligation product was used as the template DNA for the enrichment of the partial genomic library, and the adaptor-specific primers, named Mse I-N (5′-GATGAGTCCTGAGTAAN-3′), were used to perform 20 cycles of prehybridization PCR amplification. The PCR mixture contained 20 ng template DNA, 10 pmol adapter-specific primer, 2 μL 10 × reaction buffer, 2 mM dNTP mix, 2 mM MgCl2, 0.5 U Taq DNA polymerase (Promega), and sterile water was added to reach a total volume of 20 μL. The PCR protocol was set at 94°C for 5 min, followed by 18 cycles of 94°C for 30 s, 53°C for 1 min, and 72°C for 1 min, using a Labnet MultiGene 96-well Gradient Thermal Cycler (Labnet, Edison, New Jersey, USA). The amplicons were denatured and hybridized to four separated 5′-biotinylated oligonucleotide probes, (AG)15, (AC)15, (TCC)10, and (TTG)10, in 250 μL of hybridization solution at 68°C for 1 h, and 1 mg of Streptavidin MagneSphere Paramagnetic Particles (Promega) was added to the mixture solution to capture the hybridizations at 42°C for 2 h. The four enriched microsatellite DNA fragments were washed with high-salt and low-salt solutions and then used as templates for 25 cycles of PCR amplification using the adaptor-specific primers; the amplification protocol was same as that used for the prehybridization PCR. The PCR products were purified using the HiYield™ Gel PCR DNA Fragments Extraction Kit (RBC Bioscience) and then cloned using the pGEM®-T Easy Vector System (Promega). The plasmid DNAs that were purified from white colonies were digested by the restriction enzyme Eco RI (Promega) and screened using 1% agarose electrophoresis to determine the size of the inserted DNA fragments. In total, 670 white colonies were selected to purify plasmids for sequencing from Keteleeria davidiana var. formosana. The sequencing cocktail contained 200 ng plasmid DNA as the template DNA, 0.5 mM T7 or SP6 primers, 4 μL Big Dye Terminator v3.1 Ready Reaction Premix Reactions (Applied Biosystems, Carlsbad, California, USA), and sequencing buffer in a total volume of 20 μL. Selected plasmid DNAs were sequenced in both directions using an ABI PRISM® 3700 DNA Sequencer (Applied Biosystems). These sequences, including their microsatellite loci, were recognized using Tandem Repeats Finder version 4.07b[19], and a pair of specific primers for each microsatellite locus was designed using FastPCR software version 6.4.18[20].

DNA amplification and genotyping

The optimal annealing temperature was evaluated by gradient PCR using a Labnet MultiGene 96-well Gradient Thermal Cycler (Labnet) for a temperature range from 50°C to 65°C. For each Keteleeria taxon, two to three individuals were evaluated for the optimal annealing temperature. The polymorphism of the two remaining populations of K. davidiana var. formosana was evaluated using 25 individuals from each population (Table 1). To test the optimal annealing temperature, a 20 μL reaction mixture containing 20 ng template DNA, 0.2 μM each of the reverse and forward primers, 2 μL 10 × reaction buffer, 2 mM dNTP mix, 2 mM MgCl2, 0.5 U Taq DNA polymerase (Promega), and sterile water was amplified using a Labnet MultiGene 96-well Gradient Thermal Cycler (Labnet). The PCR program was set at 94°C for 5 min, followed by 30 cycles of 94°C for 40 s, a temperature gradient ranging from 50 to 65°C for 60 s, and 72°C for 60 s, and a final extension of 72°C for 10 minutes[21]. Amplicons were checked by 1% agarose electrophoresis to isolate the target DNA bands, which were confirmed by sequencing[18]. To examine the genetic polymorphisms, the PCR cocktail was amplified using the previously described program with the temperature gradient replaced by the optimal annealing temperature (Ta). The amplicons were checked by 1% agarose electrophoresis to isolate the target DNA bands, which were confirmed by sequencing[18]. The amplicons were separated by electrophoresis on a 10% polyacrylamide gel (acrylamide: bisacrylamide 29: 1, 80 V for 14–16 hours) using a 25 or 50 bp DNA Step Ladder (Promega) to determine the allele size. The bands were then imaged under UV light using the Flo Gel FGIS-3 fluorescent gel image system (Top BIO Co., Taipei, Taiwan), and the sizes of the PCR products were identified using Quantity One software version 4.62 (Bio-Rad Laboratories, Hercules, California, USA).

Data analysis

The genetic variation indices, including the number of alleles (Na), the number of effective alleles (Ne), the observed heterozygosity (Ho) and expected heterozygosity (He), Shannon’s information index (H), and fixation index (F IS ) were estimated using GenAlEx version 6.5[22]. The Hardy–Weinberg equilibrium (H WE ) was tested using Arlequin software version 3.5.1.2[23].

Results and discussion

Development of polymorphic microsatellite markers

A total of 392 microsatellite loci containing repeat motifs were discovered, with maximum and minimum lengths of 992 bps and 119 bps, respectively, and an average sequence length of 477 bps. We designed 102 primer pairs between the up- and down-flanking regions of the motifs based on the primer design parameters computed using FastPCR software version 6.4.18[20]. To test the optimal annealing temperatures, which were obtained using gradient temperature PCRs, template DNA was derived from three individuals of each of the Keteleeria taxa, which are listed in Table 1. We tested the polymorphisms for K. davidiana var. formosana using 25 individuals from each population. Finally, we selected 16 polymorphic loci from the 102 microsatellites based on the detection of unambiguous polymorphic amplicons using fixed annealing temperature PCR and a polyacrylamide gel genotyping protocol. The characteristics of the 16 polymorphic microsatellite loci are listed in Table 2. Of the 16 loci, 11 are complete microsatellite loci, consisting of 5 with a dinucleotide motif, 5 with a trinucleotide motif, and 1 with a tetranucleotide motif. Of the 5 remaining loci, 3 carried a compound motif and 2 carried an interrupted motif. The sequences of 16 loci reported in this paper are available from GenBank (accession numbers: HG518488–HG518503) (Table 2).
Table 2

Summary of general information for the 16 polymorphic microsatellite loci isolated from Keteleeria davidiana var. formosana and their transferability to six Keteleeria taxa

Locus

Repeat motif

Primer sequence(5′-3′)

Allele size (bps)

Ta(°C)

Genbank accession no.

Cross amplification

 

TW

cy

pu

ca

cp

fo

ev

TW-5

(TG)15

F: TTGTCTAGGTATTTGTGCCC

116

54

54

54

54

54

54

54

HG518488

7/7

 

R: AAACGCAGTATAAGACAGGC

 

TW-49

(CTCC)9

F: TCACTCCCTATATCCCTAGC

99

50

50

50

50

50

50

50

HG518489

7/7

 

R: GGAGAGAGAGATTGTGTTTG

 

TW-69

(CT)27(TATTTGA)3

F: CCTATATCCTCCCCCACCT

260

54

54

54

54

54

54

54

HG518490

7/7

 

R: AGGTATAGAGGGGGATAGTG

 

TW-107

(CA)4(AG)14

F: AACCAAGGATGAAACCCTAG

153

54

54

54

54

54

54

54

HG518491

7/7

 

R: AAGTGAAAGACATAGTGAGG

 

TW-172

(GA)30

F: AGACAAAGGAGAATGGTGGG

165

50

50

50

50

50

50

50

HG518492

7/7

 

R: CCATGCCATGGGTAAGATAG

 

TW-195

(CT)18

F: ATCTTCATCACTCTCCCACC

170

54

54

54

54

54

54

54

HG518493

7/7

 

R: AAGGGGAAAGTGAGAGAGGG

 

KE-6

(AC)15

F: ACGCGAGGTTTCGGGTGGCA

192

54

54

54

54

54

54

54

HG518494

7/7

 

R: CTGGGTACTGGTGCCCTGT

 

KE-54

(AC)15

F: ACCTTGCAAACTCACCAGCT

271

52

52

52

52

52

52

52

HG518495

7/7

 

R: CTATGGCTAGGTTTCCTGGGT

 

TCC-6

(AAC)9

F: TGTATGGTGTGTCAGATGC

342

56

56

56

56

56

56

56

HG518496

7/7

 

R: CCTCCTTGTGGAGTTGGCA

 

TCC-31

(TTG)5(TTC)6

F: CTTCAAAGCTGCTCGACTC

285

55

55

55

55

55

55

55

HG518497

7/7

 

R: GTTTGCTTGAGGAACAGGT

 

TCC-55

(GAA)6(CAA)12

F: CTCTTGAAGAACAGGTTGAG

288

54

54

54

54

54

54

54

HG518498

7/7

 

R: CTTCAAAGCTGCTCGGCTCT

 

TCC-139

(GAA)13

F: CCTACAAGGTTGACCCCGT

220

54

54

54

54

54

54

54

HG518499

7/7

 

R: TGCTCGCCAATGCATGACAAG

 

TCC-245

(GAA)13

F: ACGTTTGAGGAGCAGGTTG

255

50

50

50

50

50

50

50

HG518500

7/7

 

R: TGAGAGATGTTCCTGTTCTG

 

TTG-11

(CAA)10

F: GTTTTGTAGCTCTGTTGGAC

251

50

50

50

50

50

50

50

HG518501

7/7

 

R: CCATATGACCTAGCTTCCCA

 

TTG-49

(AGG)8

F: GAGATGACAGAGGCTGCTG

224

55

55

55

55

55

55

55

HG518502

7/7

 

R: GCTAGTGGGTGCACTAGGT

 

TTG-54

(GA)15(GAA)2

F: CTCGTGCTAACCCTTGATC

222

50

50

50

50

50

50

50

HG518503

7/7

 

R: GGCTACCTTAGGATGTGTGCA

 

Note: TW = K. davidiana var. formosana; cy = K. fortunei var. cyclolepis; pu = K. pubescens; ca = K. davidiana var. calcarea; cp = K. davidiana var. chien-peii; fo = K. fortune; ev = K. evelyniana; F = the forward primer; R = the reverse primer; Ta = optimized annealing temperature.

Genotyping and population genetics analysis

To examine the extent of genetic polymorphism at each locus, 25 individuals were collected in the field from each of the two remaining populations of K. davidiana var. formosana (Table 1). For the 16 new polymorphic microsatellite loci, the number of alleles per locus (Na) and the number of effective alleles (Ne) ranged from 5 to 14 and 2.59 to 11.25 in the Dawu population, respectively, and from 3 to 16 and 2.14 to 10.59 in the Pinglin population, respectively (Table 3). The observed and expected heterozygosity (Ho and He, respectively) varied from 0.44 to 1.00 (average of 0.68) and 0.61 to 0.91 (average of 0.82) in the Dawu population, respectively, and from 0.28 (average of 0.63) to 0.80 (average of 0.78) in the Pinglin population. The means of Shannon’s information index (H) and the fixation index (F IS ) were 1.93 and 0.175 and 1.73 and 0.188 in the Dawu and Pinglin populations, respectively (Table 3). Significant deviations from Hardy–Weinberg equilibrium (H WE ) were detected at 6 and 3 loci in the two populations, respectively, and these deviations were attributed to the heterozygote deficiency of the endangered species (Table 3). A total of 52 and 29 private alleles were observed in the Dawu and Pinglin populations, respectively, revealing population differentiation between the two remaining populations of the species.
Table 3

Genetic diversity characteristics of the 16 polymorphic microsatellite loci tested on two populations of Keteleeria davidiana var. formosana

 

K. davidiana var. formosana

 

Dawu population (N = 25)

Pinglin population (N = 25)

Locus

Na

Ne

Ho

He

H

F IS

Na

Ne

Ho

He

H

F IS

TW-5

5

2.59

0.44

0.61

1.18

0.284

3

2.68

0.56

0.63

1.03

0.106

TW-49

7

3.93

0.68

0.75

1.55

0.088

3

2.14

0.48

0.53

0.90

0.100

TW-69

8

5.30

0.68

0.81

1.84

0.162

7

4.73

0.64

0.79

1.71

0.189

TW-107

7

4.36

0.56

0.77*

1.68

0.273

4

3.24

0.52

0.69

1.28

0.248

TW-172

6

4.63

0.68

0.78

1.63

0.133

3

2.35

0.52

0.57

0.97

0.093

TW-195

5

4.96

0.72

0.80

1.61

0.098

6

5.00

0.72

0.80

1.66

0.100

KE-6

12

9.69

0.60

0.90*

2.37

0.331

8

7.27

0.28

0.86*

2.03

0.675

KE-54

10

7.62

0.68

0.87

2.14

0.217

8

7.23

0.68

0.86

2.02

0.211

TCC-6

10

5.79

0.80

0.83

1.98

0.033

10

8.56

0.80

0.88

2.22

0.094

TCC-31

8

5.76

0.72

0.83

1.89

0.129

9

5.73

0.72

0.83

1.96

0.128

TCC-55

10

8.50

0.68

0.88

2.22

0.229

10

8.22

0.76

0.88

2.18

0.135

TCC-139

6

4.92

0.64

0.80*

1.67

0.197

10

5.73

0.56

0.83*

1.96

0.322

TCC-245

8

6.04

0.72

0.83

1.91

0.137

4

3.33

0.72

0.70

1.29

-0.029

TTG-11

13

7.76

0.76

0.87*

2.28

0.128

8

6.19

0.72

0.84

1.93

0.141

TTG-49

14

11.26

1.00

0.91*

2.51

-0.097

10

6.87

0.80

0.85

2.06

0.064

TTG-54

13

9.92

0.48

0.90*

2.42

0.466

16

10.59

0.52

0.91*

2.55

0.426

Mean

8.88

6.44

0.68

0.82

1.93

0.175

7.44

5.62

0.63

0.78

1.73

0.188

*Significant deviation from Hardy-Weinberg equilibrium: P < 0.05.

The number of different alleles (Na), number of effective alleles (Ne), observed heterozygosity (H O ), expected heterozygosity (He), Shannon’s information index (H), and fixation index (F IS ) are reported.

The genetic variability, including the means of the observed and expected heterozygosity (Table 3), of K. davidiana var. formosana was high compared with that of other Pinaceae species such as Pinus koraiensis (0.38 and 0.57)[24] and P. massoniana (0.27 and 0.65)[25, 26], but was similar to that of P. pinaster (0.65 and 0.83)[27]. Unfortunately, no data for other Keteleeria taxa are available for the comparison of genetic variability. However, the high observed and expected heterozygosity values implied that the species was historically larger in population size and was more common in low-elevation forests than it is at present[7].

Test of transferability

To test the transferability of these microsatellite loci, we tested these primers in six other cow-tail fir taxa: K. fortunei var. cyclolepis, K. pubescens, K. davidiana var. calcarea, K. davidiana var. chienpeii, K. fortune, and K. evelyniana (Table 1). Two to three samples of each taxon were used in the evaluation of cross-amplification. All loci were transferable to the six taxa of Keteleeria (Table 4), and the annealing temperatures are listed on Table 2. However, few alleles were recovered in the six other Keteleeria taxa sampled here were caused by a small sampling effect. Nonetheless, the systematic and phylogeographic patterns among the Keteleeria species remain unclear. The transferability of these microsatellite loci among different Keteleeria taxa indicates the usefulness of these molecular genetic markers for interspecific and intraspecific research on such topics as phylogeography, speciation and introgression.
Table 4

Result of cross-species transferability in six Keteleeria taxa using the 16 microsatellite primers developed from Keteleeria davidiana var. formosana

Locus

K. fortunei var. cyclolepis(N = 3)

K. pubescens(N = 3)

K. davidiana var. calcarea(N = 3)

K. davidiana var. chienpeii(N = 2)

K. fortunei(N = 3)

K. evelyniana(N = 3)

TW-5

1

2

1

2

1

1

TW-49

2

2

2

1

1

2

TW-69

3

2

2

2

1

2

TW-107

3

1

2

2

1

1

TW-172

2

1

2

1

1

2

TW-195

2

2

3

2

2

1

KE-6

2

3

3

2

2

2

KE-54

3

3

2

1

2

2

TCC-6

3

3

3

2

3

3

TCC-31

2

3

2

2

2

1

TCC-55

3

2

1

2

1

2

TCC-139

2

3

2

1

2

2

TCC-245

2

2

2

2

2

1

TTG-11

3

3

3

2

3

3

TTG-49

3

2

3

2

3

3

TTG-54

2

2

3

2

2

2

For loci that were successfully amplified, the number of alleles is given.

Conclusions

For conservation purposes, 16 new polymorphic microsatellite loci were developed from K. davidiana var. formosana. The genetic variation indices evaluated using these 16 polymorphic microsatellite loci for the two remaining populations of this endangered species are potentially useful for future studies that will focus on identifying distinct evolutionary units within the populations for conservation management. The interspecies transferability of these microsatellite loci may also be useful for future research aiming to reconstruct the phylogeographic patterns and the process of speciation among closely related species.

Availability of supporting data

The microsatellite sequences are available through the National Centre for Biotechnology Information (seehttp://www.ncbi.nlm.nih.gov/). The accession numbers on the repository are the following: GenBank accession number HG518488 through HG518503.

Declarations

Acknowledgments

We thank Dr. Xun Gong and Dr. Jianwen Dong for their assistance in collecting the related species. We also thank two anonymous reviewers for their helpful comments. This work was supported by grants from the National Science Council, Taiwan (NSC 98-2815-C-020-014-B, 98-2621-B-110-004-MY3, 100-2621-B-110-001-MY3, and NSC 102-2628-B-110 -001 -MY3) and the Forestry Bureau, Council of Agriculture, Republic of China (tfba-1010621) to Y-C Chiang.

Authors’ Affiliations

(1)
Graduate Institute of Bioresources, National Pingtung University of Science and Technology
(2)
Department of Nursing, Meiho University
(3)
Department of Biological Sciences, National Sun Yat-sen University
(4)
Department of Biology, National Museum of Natural Science
(5)
Conservation Division, Forestry Bureau, Council of Agriculture
(6)
Botanical Garden Division, Taiwan Forestry Research Institute
(7)
Department of Life Sciences, National Chung Hsing University
(8)
Department of Forestry, National Pingtung University of Science and Technology
(9)
Endemic Species Research Institute

References

  1. Chiang YC, Shih HC, Chang LW, Li WR, Lin HY, Ju LP: Isolation of 16 polymorphic microsatellite markers from an endangered and endemic species, Podocarpus nakaii (Podocarpaceae). Am J Bot. 2011, 98: e306-e309. 10.3732/ajb.1100229.PubMedView ArticleGoogle Scholar
  2. Ho CS, Chen CT, Ko YZ, Ge XJ, Hung KH, Hsu TW, Chiang YC: Isolation and characterization of 15 microsatellite loci in four endangered Amentotaxus species (Taxaceae). Am J Bot. 2012, 99: e157-e159. 10.3732/ajb.1100452.PubMedView ArticleGoogle Scholar
  3. Ju LP, Shih HC, Chiang YC: Microsatellite primers for the endangered beech tree, Fagus hayatae (Fagaceae). Am J Bot. 2012, 99: e453-e456. 10.3732/ajb.1200118.PubMedView ArticleGoogle Scholar
  4. Huang S, Chiang YC, Schaal BA, Chou CH, Chiang TY: Organelle DNA phylogeography of Cycas taitungensis, a relict species in Taiwan. Mol Ecol. 2001, 10: 2669-2681. 10.1046/j.0962-1083.2001.01395.x.PubMedView ArticleGoogle Scholar
  5. Huang S, Hsieh HT, Fang K, Chiang YC: Patterns of genetic variation and demography of Cycas taitungensis in Taiwan. Bot Rev. 2004, 70: 86-92. 10.1663/0006-8101(2004)070[0086:POGVAD]2.0.CO;2.View ArticleGoogle Scholar
  6. Ju LP, Kuo CC, Chao YS, Cheng YP, Gong X, Chiang YC: Microsatellite primers in the native perennial cycad, Cycas taitungensis (Cycadaceae). Am J Bot. 2011, 98: e84-e86. 10.3732/ajb.1000504.PubMedView ArticleGoogle Scholar
  7. Fang JY, Chung JD, Chiang YC, Chang CT, Chen CY, Hwang SY: Divergent selection and local adaptation in disjunct populations of an endangered conifer, Keteleeria davidiana var. formosana (Pinaceae). PLoS One. 2013, 8: e70162-10.1371/journal.pone.0070162.PubMedPubMed CentralView ArticleGoogle Scholar
  8. Frankham R, Ballou JD, Briscoe DA: Introduction to Conservation Genetics. 2002, Cambridge, UK:. Cambridge University PressView ArticleGoogle Scholar
  9. Schneider D, Wink M, Sporer F, Lounibos P: Cycads: their evolution, toxins, herbivores and insect pollinators. Naturwissenschaften. 2002, 89: 281-294. 10.1007/s00114-002-0330-2.PubMedView ArticleGoogle Scholar
  10. Frankham R: Genetics and conservation biology. C R Biol. 2003, 326: S22-S29.PubMedView ArticleGoogle Scholar
  11. Luscombe D, Yang Y: Keteleeria davidiana var. formosana. IUCN 2013. IUCN Red List of Threatened Species. 2013, 1-Google Scholar
  12. Farjon A: A second revision of the genus Keteleeria Carrière (Taxonomic notes on Pinaceae II). Notes Roy Bot Gard Edinburgh. 1989, 46: 81-99.Google Scholar
  13. Li HL, Hsuan K: Pinaceae. Flora of Taiwan, 1, Volume 2. Edited by: Committee of the Flora of Taiwan. 1994, Taipei, Taiwan, 568-569. 2Google Scholar
  14. Chiang YC: Research report for 101 annual science and technology program of forestry bureau. Research Project: Identification the Genetic Units for Conservation and Restoration of Keteleeria davidiana var. formosana. 2012, Taipei, Taiwan: Council of AgricultureGoogle Scholar
  15. Kanehira R: Pinaceae. Formosan trees: Indigenous to the island (revised). 1936, Taipei, Formosa: Department of Forestry, Government Research Institute, 39-41.Google Scholar
  16. Zane L, Bargelloni L, Patarnello T: Strategies for microsatellite isolation: A review. Mol Ecol. 2002, 11: 1-6. 10.1046/j.0962-1083.2001.01418.x.PubMedView ArticleGoogle Scholar
  17. Liao PC, Gong X, Shih HC, Chiang YC: Isolation and characterization of eleven polymorphic microsatellite loci from an endemic species, Piper polysyphonum (Piperaceae). Conserv Genet. 2009, 10: 1911-1914. 10.1007/s10592-009-9852-x.View ArticleGoogle Scholar
  18. Hsu TW, Shih HC, Kuo CC, Chiang TY, Chiang YC: Characterization of 42 microsatellite markers from poison ivy, Toxicodendron radicans (Anacardiaceae). Int J Mol Sci. 2013, 14: 20414-20426. 10.3390/ijms141020414.PubMedPubMed CentralView ArticleGoogle Scholar
  19. Benson G: Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res. 1999, 27: 573-580. 10.1093/nar/27.2.573.PubMedPubMed CentralView ArticleGoogle Scholar
  20. Kalendar R, Lee D, Schulman AH: Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis. Genomics. 2011, 98: 137-144. 10.1016/j.ygeno.2011.04.009.PubMedView ArticleGoogle Scholar
  21. Chiang YC, Shih HC, Huang MC, Ju LP, Hung KH: Characterization of microsatellite loci from Litsea hypophaea (Lauraceae), a tree endemic to Taiwan. Am J Bot. 2012, 99: e251-e254. 10.3732/ajb.1100551.PubMedView ArticleGoogle Scholar
  22. Peakall R, Smouse PE: GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics. 2012, 28: 2537-2539. 10.1093/bioinformatics/bts460.PubMedPubMed CentralView ArticleGoogle Scholar
  23. Excoffier L, Lischer HEL: Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour. 2010, 10: 564-567. 10.1111/j.1755-0998.2010.02847.x.PubMedView ArticleGoogle Scholar
  24. Yu JH, Chen CM, Tang ZH, Yuan SS, Wang CJ, Zu YG: Isolation and characterization of 13 novel polymorphic microsatellite markers for Pinus koraiensis (Pinaceae). Am J Bot. 2012, 99: e421-e424. 10.3732/ajb.1200145.PubMedView ArticleGoogle Scholar
  25. Hung KH, Lin CY, Huang CC, Hwang CC, Hsu TW, Kuo YL, Wang WK, Hung CY, Chiang TY: Isolation and characterization of microsatellite loci from Pinus massoniana (Pinaceae). Bot Stud. 2012, 53: 191-196.Google Scholar
  26. Ge XJ, Hsu TW, Hung KH, Lin CJ, Huang CC, Huang CC, Chiang YC, Chiang TY: Inferring mutiple refugia and phylogeographical patterns in Pinus massoniana based on nucleotide sequence variation and DNA fingerprinting. PLoS One. 2012, 7: e43717-10.1371/journal.pone.0043717.PubMedPubMed CentralView ArticleGoogle Scholar
  27. Mariette S, Chagné D, Lézier C, Pastuszka P, Raffin A, Plomion C, Kremer A: Genetic diversity within and among Pinus pinaster populations: comparison between AFLP and microsatellite markers. Heredity. 2001, 86: 469-479. 10.1046/j.1365-2540.2001.00852.x.PubMedView ArticleGoogle Scholar

Copyright

© Ho et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement