Skip to content


BMC Research Notes

Open Access

Early-flowering sweet orange mutant ‘x11’ as a model for functional genomic studies of Citrus

  • Thaísa Tessutti Pinheiro1, 2,
  • Antonio Figueira1 and
  • Rodrigo Rocha Latado2Email author
BMC Research Notes20147:511

Received: 15 January 2014

Accepted: 7 August 2014

Published: 10 August 2014



There had been many reports on genetic transformation of Citrus for functional genomic studies but few included genes associated with flower or fruit traits. A major reason for this might derive from the extensive juvenile stage of Citrus plants when regenerated from juvenile explants (epicotyls, cotyledon or calli), which delays the observation of the resulting phenotype. Alternatives include the use of explants from adult tissues, which sometimes may be recalcitrant to regeneration or transformation, or of early-flowering genotypes. However, there is no report about the use of early-flowering sweet orange mutants for functional genomic studies.


Here, we propose a sweet orange spontaneous early-flowering mutant, named ‘x11’, as a platform for Citrus functional genomic studies, particularly for genes associated with flower or fruit traits. We report a procedure for efficient regeneration and transformation using epicotyl segment explants of ‘x11’ and Agrobacterium tumefaciens as a proof-of-concept. The average transformation efficiency was 18.6%, but reached 29.6% in the best protocol tested. Among 270 positive shoots, five were in vitro micrografted and acclimatized, followed by evaluation of transgene expression by quantitative amplification of reversed transcripts (RT-qPCR) and determination of the number of copies inserted. Four of these plants, containing from one to four copies of the transgene, exhibited the first flowers within three months after ex vitro establishment, and the other, two months later, regardless of the period of the year. Flowers of transgenic plants displayed fertile pollen and gynoecium, with self-pollination inducing fruit development with seeds. Histochemical staining for β-glucuronidase activity using stem segments, flowers and fruits from 5 to 7 month-old acclimatized transgenic plants confirmed the constitutive transgene expression in these organs.


The ‘x11’ sweet orange is suitable for functional genomics studies with a satisfactory transformation rate, and it can be considered a good model for functional genomic studies in commercial sweet oranges, for traits related to flower and fruit.


FlowerFruitGeneJuvenilityModel systemTransgenic


Citrus species are perennial plants with a long juvenile period, which represents a barrier for conventional breeding by controlled hybridization[1]. The juvenile stage of Citrus plants propagated by seeds can last from 5 to 22 years, depending on the species and genotype[2]. Consequently, genetic transformation has been considered an important breeding alternative for Citrus as a mean of introducing desirable traits in elite cultivars without affecting a highly favorable genotypic combination, by avoiding recombination during meiosis[3].

There are many reports about gene introduction in several Citrus species, mostly involving resistance to biotic[47] or abiotic stresses[8, 9]. However, there have been few reports about traits associated with reproductive organs, mostly with fruits, which included attempts to improve fruit skin or pulp[1012] or the use of antisense of 1-aminocyclopropane-1-carboxylate synthase gene to transform ‘Carrizo’ citrange, sweet orange and Poncirus trifoliata (L.) Raf. to repress the increase of 1-aminocyclopropane-1-carboxylate (ACC) content following chilling treatment of fruits[13]. Regarding flowers, there is a report about transformation of juvenile Citrus seedlings to constitutively express the arabidopsis Leafy (lfy) or Apetala 1 (ap1) genes to promote flower initiation and fruiting as early as the first year after planting[1]. A major reason for the limited number of reports might derive from the extensive juvenile stage of Citrus plants when regenerated from juvenile explants, which delays the observation of the resulting phenotype.

Adult-derived explants can be used as an alternative to avoid the extensive juvenile stage of Citrus[6, 1417]. However, the use of mature explants is limited as they are usually more recalcitrant to infection and to genetic transformation by Agrobacterium tumefaciens, with low transformation efficiency[12] and the possibility of reduced rooting capacity of the regenerated plantlets[18].

As a consequence of the increasing availability of genomic information, there is an urgent need to facilitate the determination of Citrus gene function. Citrus functional genetics have been predominantly conducted in model systems, such as tomato and Arabidopsis[19, 20]. Despite the importance and speediness by using these model systems, there are critical differences in species development, gene family structure or individual response for each genotype, which can result in contrasting genetic information[21].

One possible alternative to investigate gene functions in Citrus for the observation of flower and fruit phenotypes in a shorter time can be the use of early flowering genotypes, such as ‘Lima West Indian’ [C. aurantifolia (Christm.) Swingle][22]; ‘Kumquat’ (Fortunella crassifolia Swingle)[23]; or the spontaneous Poncirus trifoliata (L.) Raf. mutant[24], which were all evaluated for genetic transformation[12, 25]. All these species/genotypes offer the potential to be used in functional genomic studies[12], but they are less attractive than sweet orange genotypes [C. sinensis (L.) Osbeck], because of their limited commercial interest.

The spontaneous mutant ‘x11’ was selected from trees of the sweet orange ‘Tobias’, an early-flowering cultivar with polyembryonic seeds[26], grown at the Citrus germplasm repository of the ‘Centro de Citricultura Sylvio Moreira’, Cordeirópolis, São Paulo, Brazil by Dr. Rodrigo R. Latado in 2006. The mutant sport was subsequently budded to select for a solid (non-chimerical) mutant plant. ‘x11’ differs from ‘Tobias’ as a more compact plant, with fruits with higher seed number (approximately 6.0) (R.R. Latado, unpublished observations). Seedlings of ‘x11’ bloom repeatedly in all seasons, without the requirement of environmental stimuli, except for pruning, which stimulates the production of new shoots (18-24 cm long; 9-12 leaves), usually with a terminal flower, 30-40 days later. Male and female organs are viable (ranging from 53 to 92% fertility, according with the season), and pollen germination rate varies between 25 to 55%, resulting in an easy fruit set after pollination (R.R. Latado, unpublished observations). Despite the fact that ‘x11’ seedlings produce complete and fertile flowers, abortion tends to occur when the plants are still small. However, if juvenile buds are grafted onto large or adult plants, the rate of fruit set reaches a normal level. The average yield of ‘x11’ plants still needs to be evaluated upon field conditions, but there is an expectation to be similar to the one observed for ‘Tobias’, of approximately 61 kg plant-1 year-1[26]. These attributes make ‘x11’ an attractive functional genomic model to investigate gene functions associated with flower and fruit development and traits in a shorter period of time (one to two years) in sweet orange.

Despite the significant progress in establishing genetic transformation protocols by A. tumefaciens, some Citrus genotypes are still recalcitrant, with low transformation efficiency[10]. Since transformation rate is genotype-specific, there is a requirement to optimize conditions to produce transgenic for each genotype[27]. Here, we described the genetic transformation of the early-flowering sweet orange ‘x11’ using A. tumefaciens with a reporter gene β-glucuronidase (uidA) driven by the 35S cauliflower mosaic virus (CaMV) promoter as a proof-of-concept for adopting this genotype as a platform for functional Citrus genomic studies of flower and fruit-related gene function analyses in Citrus, particularly sweet orange.

Results and Discussion

Genetic transformation of ‘x11’ sweet orange

Several experiments were previously conducted to optimize the conditions of genetic transformation of ‘x11’ epicotyl explants, including the determination of 6-benzylaminopurine (BAP) concentration on the regeneration media; kanamycin concentration for selection of transgenic events; and inoculation and co-cultivation conditions (Additional file1 Table S1). The best transformation and regeneration conditions for epicotyl segments of ‘x11’ sweet orange tested, resulted in regeneration efficiency of shoots ranging between 1.0 and 3.8 shoots per explant in experiments without co-cultivation with A. tumefaciens (control), or 0.2 to 0.5 shoot per explant, when explants were co-cultivated in bacterial solution. A total of 1,447 explants were used in transformation experiments, resulting in 475 regenerating shoots, from which 270 were positive for GUS staining. GUS-positive shoots represented approximately 57% of the total analyzed shoots, with an average transformation efficiency of 18.6%.

Transformation efficiency of Citrus is genotype-dependent, and rates reported have ranged from 2% in ‘Ridge pineapple’ sweet orange[28] to 87.7% in P. trifoliata[29]. Transformation efficiency of the protocol defined here for ‘x11’ sweet orange reached in certain experiments up to 29.8% (Supplementary Table 1), similar to rates reported for other sweet oranges, such as ‘Valencia’ (23.8%)[30] or ‘Hamlin’ (25%)[27]; ‘Carrizo’ citrange (20.6%)[31]; or the early-flowering P. trifoliata mutant (20.7%)[12], but superior to those described for ‘Mexican’ lime (8%)[27] and sour orange (2.4%)[28].
Table 1

Estimated and assumed copy number of the nptII transgene of five ‘x11’ transgenic plants


Estimated copy number

Assumed copy number

Control (Non Transformed)


















Characterization of transgenic shoots and plants

Among the 270 GUS-positive shoots, five were in vitro micrografted onto ‘Carrizo’ citrange seedlings and then, acclimatized to greenhouse conditions. Four transgenic plants exhibited the first flowers within three months after establishment ex vitro (Figure 1), and the other, two months later (five months after acclimatization), regardless of the time of year. All plants presented the same phenotype, with a terminal flower in almost all developed shoots. Flowers displayed fertile pollen (not shown) and gynoecium, with self-pollination inducing fruit development with seeds.
Figure 1

Tissues of the ‘x11’ sweet orange plant #1 transformed with pCAMBIA2301 expressing uidA gene. A) cross-section of stem segment; B) floral pedicel; C) flower after anthesis; D ) middle section of the fruit; E) transgenic ‘x11’ sweet orange plant event #1 at the flowering stage, three months after acclimatization; F) transgenic ‘x11’ sweet orange plant with mature fruits, approximately 14 months after acclimatization.

Histochemical staining for uidA (GUS) activity using stem segments, flowers and fruits from 5 to 7 month-old acclimatized transgenic plants confirmed the constitutive expression of uidA gene in these organs (Figure 1). PCR analyses of the five putative transgenic (GUS-positive) plants indicated the presence of a 203 bp fragment, equivalent to the expected amplicon of the neomycin phosphotransferase (nptII) gene (not shown). When these plants were analyzed for the number of copies of transgenes inserted, the evaluated amplification efficiency of the primers for the target gene (nptII) and for the endogenous reference gene (lipid transfer protein - ltp) was around 100%. The virtual calibrator (r1 coefficient) was calculated for nptII as described by Mason et al.[32], and in this experiment, the r1 value was estimated to be 0.8. Thus, it was estimated that among the five putative transgenic plants analyzed, the events #1, #3 and #4 presented a single copy of the transgene nptII, while the plant #5 contained two copies and the plant #2 showed four copies (Table 1). The copy number of transgene in event #3 was estimated to be 0.2 using the method described by Mason et al.[32]. However, it was demonstrated by GUS histochemical staining, PCR amplification and nptII gene expression analyses that this plant is transgenic. Therefore, it was assumed that one single copy of the the nptII transgene was inserted.

This type of uncertainty in estimating the number of copies of transgenes has been observed in several reports[3235]. This may occur in some cases due to fact that the qPCR reaction cannot detect rearrangements of T-DNA during insertion into the host chromosome or because the possible occurrence of partial loss of the transgene in the expression cassette. Nevertheless, this method can be considered as simple, fast, efficient and with high sensitivity in comparison with other methods, such as Southern blot and, therefore, is considered reliable to estimate the transgene copy number[32].

The level of transgene expression varied between the events evaluated, with the highest number of transcripts accumulated observed in event #1 (~135,000x more than the control plant; Figure 2), which contained a single copy of the transgene, while the smallest number of transcripts was detected for event #5 (Figure 2), with estimated two copies of the transgene. Previous studies have indicated that plants with larger number of transgene copies resulted in a lower level of transgene expression, unstable expression or even gene silencing[36, 37]. On the other hand, the insertion of only one or two copies tends to result in higher levels of expression[38, 39].
Figure 2

Relative expression of the nptII gene. Relative expression of the nptII gene in control and in transgenic plants #1, #2, #3, #4 and #5, transformed with pCAMBIA2301, in relation to the gene encoding Eukaryotic Translation Initiation Factor 5A (IF5A) used as a reference gene.

Prospects for sweet orange functional genomics

With the completion of the genome sequences from important Citrus species [[40],], together with the availability of vast amount of expressed sequences[41, 42] and protein data[43, 44], there is an urgent requirement for establishing a functional genomic platform to uncover several gene functions, involved in structural, signaling and regulatory pathways in sweet orange fruits, the economic focus of Citrus production. Many plant species have been used as an ortologous model system, such as arabidopsis and tomato, to investigate Citrus gene functions[19, 45]. However, these model systems may differ for specific gene function, or regulation and signaling. The evaluation of specific promoters is also hampered in ortologous model systems.

Our results indicated that the sweet orange mutant ‘x11’ is suitable for functional genomic studies. We showed that ‘x11’ is able to blossom and produce fruits around 5 months after hardening upon greenhouse conditions, expressing the transgene. Other species have been proposed to be used in functional genomics studies, including the early-fruiting P. trifoliata[12, 25], or the short juvenile phase C. aurantifolia[22] and kumquat (Fortunella sp.)[23]; however, none of these species exhibit the large commercial interest as the sweet orange ‘x11’, the short juvenile stage, nor comparable transformation efficiency described here. Seeds from ‘x11’ can be provided in limited amounts upon request for research purposes only.


The results demonstrated the concept that the early-flowering sweet orange ‘x11’ mutant appears as a suitable genotype for functional genomic studies of target genes involved in the processes of flowering and fruiting, enabling the quick evaluation of resulting phenotypes.


Plant material and explant source

Seeds from the early-flowering sweet orange mutant ‘x11’ were obtained from field-grown plants. In a laminar flow-hood, seed coat was removed and embryos were superficially disinfected in 50% commercial solution of sodium hypochlorite (final concentration of 1-1.5% active chlorine). Embryos were then germinated in test tubes containing 10 mL semi-solid MS media supplemented with 7 g L-1 agar. Tubes were maintained in the dark for 30 days at a 25 ± 1°C for epicotyl elongation, followed by cultivation under light (50 μmol m-2 s-1 at 16 h photoperiod) for another 15 days. One-cm epicotyl segments were then cut and used as explants.

Transformation vector

A. tumefaciens strain EHA105[46] containing pCAMBIA2301 [] plasmid was used for transformation. The plasmid contained the plant selection gene nptII and the reporter gene uidA under the control of the CaMV35S promoter and the nopaline synthase (nos) gene terminator.

Genetic transformation of ‘x11’ explants

To improve the efficiency of epicotyl segment regeneration and transformation of ‘x11’ explants some parameters were evaluated in preliminary experiments, such as: BAP 6-benzylaminopurine concentration in regeneration medium; kanamycin concentration used for transgenic selection; inoculation time of Agrobacterium; co-cultivation temperature and days of co-cultivation (Additional file1 Table S1). The efficiencies and quantities of explants evaluated are presented at Supplementary Table 1. In the recommended protocol for genetic transformation experiments, A. tumefaciens cells were grown in 20 mL LB media, supplemented with 50 mg L-1 kanamycin and 100 mg L-1 rifampicin for 16 h at 28°C on an orbital shaker (120 rpm). The bacteria suspension was centrifuged at 5,000 g for 15 min, and the pellet was resuspended in T1 media [MS salts and vitamins; 25 g L-1 sucrose; 0.5 g L-1 malt extract (Sigma; Saint Louis, MO, USA) and 0.1 g L-1 myo-inositol] supplemented with 0.5 mg L-1 2,4-dichlorophenoxiacetic acid (2,4-D) and 200 μM acetosyringone at pH 5.4, to OD600 = 0.6. Epicotyl segments were excised and exposed to the Agrobacterium suspension under agitation at 100 rpm. The period of co-cultivation time was 30 min (co-cultivation time previously tested 10 - 30 min). The excess suspension was dried off using sterile filter paper. Explants were then co-cultivated with Agrobacterium on T1 media supplemented with 1.5 mg L-1 BAP, 0.01 mg L-1 2,4-D, 100 μM acetosyringone and 7 g L-1 agar (pH 5.8) in the dark, at 25 ± 1°C (temperatures of co-cultivation previously evaluated: 22 – 28°C), for three days (period of co-cultivation previously evaluated: one - four days). Then, explants were transferred to fresh T1 media supplemented with 1.5 mg L-1 BAP; 100 μM acetosyringone; 7 g L-1 agar (pH 5.8); 500 mg L-1 cefotaxime and 50 mg L-1 kanamycin (kanamycin concentrations previously tested for inhibition of shoot regeneration: from 0 to 150 mg L-1). Explants were kept at 25 ± 1°C under 50 μmol m-2 s-1 and 16 h photoperiod, transferring to fresh media every 15 days until shoot regeneration.

Three experiments of genetic transformation were performed using the same procedures. The number of regenerated shoots (more than 4 mm) per explants was evaluated after 45 days of cultivation and the regeneration efficiency was calculated. All 60-day-old shoots were individually analyzed using histochemical GUS staining[47], and the transformation efficiency was estimated by the ratio number of GUS-positive shoots over the number of inoculated explants, and the percent of GUS-positive shoots.

Acclimatization and confirmation of transgenic plants

Some GUS-positive shoots transformed with pCAMBIA2301 were in vitro micrografted onto ‘Carrizo’ citrange and transferred to liquid T1 media supplemented with 25 g L-1 sucrose, at 25 ± 1°C, under 50 μmol m-2 s-1 and 16 h photoperiod, for 15 days. Plantlets were acclimatized and transferred to 20 L pots with a 1:1 mixture of soil and substrate in the greenhouse. Stem segments, first flowers and fruits of transgenic plants for pCAMBIA2301 were sampled and used for GUS histochemical staining.

Transformation was confirmed by amplification using total genomic DNA, extracted according to Doyle and Doyle[48]. Specific primers for the nptII gene (For: CAATAGCAGCCAGTCCCTTC and Rev: AGACAATCGGCTGCTCTGAT) were developed using Primer3[49], with an expected amplicon of 203 bp. The amplification reaction was conducted on a GeneAmp 9700 thermocycler (Applied Biosystems; Foster City, CA, USA) in a final volume of 25 μL with 25 ng DNA in Taq buffer containing (NH4)2SO4 [75 mM Tris-HCl, pH 8.8; 20 mM (NH4)2SO4]; 2 mM MgCl2; 200 μM of each dNTPs; 0.2 μM of each primer and 1 U Taq polymerase (Fermentas; Burlington, Canada). The amplifications started at 95°C for 2 min, followed by 29 cycles of 30 s at 95°C; 30 s at 60°C; 40 s at 72°C, followed by a final extension of 5 min at 72°C. Products were detected by 1% agarose gel electrophoresis.

Estimation of number of transgene copies inserted and analysis of gene expression by quantitative amplification of reversed transcripts (RT-qPCR)

Five transgenic plants were analyzed by real time PCR method using SYBR Green to determine gene expression and to estimate the number of inserted copies. To estimate the number of transgene copies, primers for the nptII transgene (primers above) and for the endogenous ltp gene [GenBank AF369931] (ACACCTGACCGCCAAACT and AAGGAATGCTGACT CCACAAG; amplicon size = 115 bp), present as two copies in C. sinensis genome[50, 51], were used in amplification reactions with genomic DNA from five transgenic plants plus the respective control plant. The qPCR amplification reactions were performed in triplicate, in a final volume of 10 μL containing 1 μL cDNA 1:10 (v/v) dilution; 0.5 μM of each transcript-specific primers and 5 μL 2X Platinum SYBR-Green RT-qPCR SuperMix-UDG (Invitrogen; Carlsbad, CA, USA). Estimation of copy number of the transgene was conducted as described by Mason et al.[32] and Omar et al.[33]. Standard curves were prepared for the nptII transgene and for the endogenous ltp gene. These levels were compared with the experimental estimation in control and transgenic samples, and the amount of transgene was divided by the value of the endogenous gene. Then, the r1 coefficient (called ‘virtual calibrator’) was calculated for the nptII transgene using data from all transgenic and control plants, as described by Mason et al.[32].

For gene expression analysis, total RNA was extracted from five putative transgenic plants and from one non-transgenic plant according with the protocol described by Tao et al.[52]. The target transgene was nptII (primers above) and the reference gene was the Eukaryotic Translation Initiation Factor 5A (IF5A) [TIGR: TC17010] (ACTGAAACCGGAAACACCAA and TTTCCTTCAGCAAACCCATC; amplicon size 89 pb). cDNA synthesis was conducted as described by Pinheiro et al.[53] and the RT-qPCR reactions were performed as described above in the experiment for analysis of nptII transgene expression. Amplifications were performed in a RotorGene 3000 thermocycler (Corbett Life Science; Sidney, Australia) in triplicates, with initial incubation at 50°C for 2 min and 95°C for 2 min, followed by 40 cycles of 95°C for 15 s; 60°C for 15 s, and 72°C for 20 s, with fluorescence detection at the end of the extension cycles. After the final cycle, melting curves for each amplicon were determined between 72 and 95°C.



This work was partially funded by the Brazilian ‘Conselho Nacional de Desenvolvimento Científico e Tecnológico’ (CNPq). The authors (TTP and AF) are grateful for the fellowships provided by CNPq.

Authors’ Affiliations

Centro de Energia Nuclear na Agricultura, Universidade de São Paulo, Piracicaba, Brazil
Centro de Citricultura “Sylvio Moreira”, Instituto Agronômico, Cordeirópolis, Brazil


  1. Peña L, Martín-Trillo M, Juárez J, Pina JA, Navarro L, Martínez-Zapater JM: Constitutive expression of Arabidopsis LEAFY or APETALA1 genes in citrus reduces their generation time. Nat Biotechnol. 2001, 19: 263-267.PubMedView ArticleGoogle Scholar
  2. Endo T, Shimada T, Fujii H, Kobayashi Y, Araki T, Omura M: Ectopic expression of an FT homolog from Citrus confers an early flowering phenotype on trifoliate orange (Poncirus trifoliata L. Raf.). Transgenic Res. 2005, 14: 703-712.PubMedView ArticleGoogle Scholar
  3. Deng X, Duan Y: Modification of perennial fruit trees. Tree Transgenesis: Recent Developments. Edited by: Fladung M, Ewald D. 2006, Heidelberg: Springer, 47-66.View ArticleGoogle Scholar
  4. Zanek MC, Reyes CA, Cervera M, Peña EJ, Velásquez K, Costa N, Plata MI, Grau O, Peña L, García M: Genetic transformation of sweet orange with the coat protein gene Citrus psorosis virus and evaluation of resistance against the virus. Plant Cell Rep. 2008, 27: 57-66.PubMedView ArticleGoogle Scholar
  5. Mendes JM, Mourão Filho FAA, Bergamin Filho A, Harakava R, Beer SV, Mendes BMJ: Genetic transformation of Citrus sinensis cv. Hamlin with hrpN gene from Erwinia amylovora and evaluation of the transgenic lines for resistance to citrus canker. Sci Hortic. 2009, 122: 109-115.View ArticleGoogle Scholar
  6. He Y, Chen S, Peng A, Zou X, Xu L, Lei T, Liu X, Yao L: Production and evaluation of transgenic sweet orange (Citrus sinensis Osbeck) containing bivalent antibacterial peptide genes (Shiva A and Cecropin B) via a novel Agrobacterium-mediated transformation of mature axillary buds. Sci Hortic. 2011, 128: 99-107.View ArticleGoogle Scholar
  7. Yang L, Hu C, Zhang J, Yan J, Deng Z: Transformation of sweet orange [Citrus sinensis (L.) Osbeck] with pthA-nls for acquiring resistance to citrus canker disease. Plant Mol Biol. 2011, 75: 11-23.PubMedView ArticleGoogle Scholar
  8. Cervera M, Orgeta C, Navarro A, Navarra L, Peña L: Generation of citrus plants with the tolerance to salinity gene HAL2 from yeast. J Hortic Sci Biotech. 2000, 75: 26-30.Google Scholar
  9. Fagoaga C, Tadeo FR, Iglesias DJ, Huerta L, Lliso I, Vidal AM, Talón M, Navarro L, García-Martínez JL, Peña L: Engineering of gibberellin levels in citrus by sense and antisense overexpression of a GA 20-oxidase gene modifies plant architecture. J Exp Bot. 2007, 58: 1407-1420.PubMedView ArticleGoogle Scholar
  10. Costa MGC, Otoni WC, Moore GA: An evaluation of factors affecting the efficiency of Agrobacterium-mediated transformation of Citrus paradisi (Macf.) and production of transgenic plants containing carotenoid biosynthetic genes. Plant Cell Rep. 2002, 21: 365-373.View ArticleGoogle Scholar
  11. Guo W, Duan Y, Olivares-Fuster O, Wu Z, Arias CR, Burns JK, Grosser JW: Protoplast transformation and regeneration of transgenic Valencia sweet orange plants containing a juice quality-related pectin methylesterase gene. Plant Cell Rep. 2005, 24: 482-486.PubMedView ArticleGoogle Scholar
  12. Tan B, Li D, Xu S, Fan G, Fan J, Guo W: Highly efficient transformation of the GFP and MAC12.2 genes into precocious trifoliate orange (Poncirus trifoliata [L.] Raf), a potential model genotype for functional genomics studies in Citrus. Tree Genet. Genomes. 2009, 5: 529-537.View ArticleGoogle Scholar
  13. Wong WS, Li GG, Ning W, Xu ZF, Hsiao WLW, Zhang LY, Li N: Repression of chilling-induced ACC accumulation in transgenic citrus by over-production of antisense 1-aminocyclopropane-1-carboxylate synthase RNA. Plant Sci. 2001, 161: 969-977.View ArticleGoogle Scholar
  14. Ghorbel R, Dominguez A, Navarro L, Peña L: Efficiency genetic transformation of sour orange (Citrus aurantium L.) and production of transgenic trees containing the coat protein gene of citrus tristeza virus. Tree Physiol. 2000, 20: 1183-1189.PubMedView ArticleGoogle Scholar
  15. Almeida WAB, Mourão Filho FAA, Pino LE, Boscariol RL, Rodriguez APM, Mendes BMJ: Genetic transformation and plant recovery from mature tissues of Citrus sinensis L. Osbeck. Plant Sci. 2003, 164: 203-211.View ArticleGoogle Scholar
  16. Cervera M, Juarez J, Navarro L, Peña L: Genetic transformation of mature citrus plants. Methods Mol Biol. 2005, 286: 177-188.PubMedGoogle Scholar
  17. Cervera C, Navarro A, Navarro L, Peña L: Production of transgenic adult plants from Clementine mandarin by enhancing cell competence for transformation and regeneration. Tree Physiol. 2008, 28: 55-66.PubMedView ArticleGoogle Scholar
  18. Moore GA, Jacono CC, Neidigh JL, Lawrence SD, Cline K: Agrobacterium-mediated transformation of Citrus stem segments and regeneration of transgenic plants. Plant Cell Rep. 1992, 11: 238-242.PubMedGoogle Scholar
  19. Sorkina A, Bardosh G, Liu YZ, Fridman I, Schlizerman L, Zur N, Or E, Goldschmidt EE, Blumwald E: Isolation of a citrus promoter specific for reproductive organs and its functional analysis in isolated juice sacs and tomato. Plant Cell Rep. 2011, 30: 1627-1640.PubMedView ArticleGoogle Scholar
  20. Marques MC, Alonso-Cantabrana H, Forment J, Arribas R, Alamar S, Conejero V, Perez-Amador MA: A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus. BMC Genomics. 2009, 10: 428-PubMedPubMed CentralView ArticleGoogle Scholar
  21. Talon M, Gmitter FG: Citrus Genomics. Int J Plant Genomics. 2008, 2008: 528361-PubMedPubMed CentralView ArticleGoogle Scholar
  22. Koltunow AM, Brennan P, Protopsaltis S, Nito N: Regeneration of West Indian limes (Citrus aurantifolia) containing genes for decreased seed set. Acta Hortic. 2000, 535: 81-91.View ArticleGoogle Scholar
  23. Yang L, Xu CJ, Hu GB, Chen KS: Establishment of an Agrobacterium–mediated transformation system for Fortunella crassifolia. Biol Plantarum. 2007, 51: 541-545.View ArticleGoogle Scholar
  24. Liang SQ, Zhu WX, Xiang WT: Precocious trifoliate orange (Poncirus trifoliata L. Raf.) biology characteristic and its stock experiment. Zhe Jiang Citrus. 1999, 16: 2-4.Google Scholar
  25. Tong Z, Tan B, Zhang J, Hu Z, Guo W, Deng X: Using precocious trifoliate orange (Poncirus trifoliata [L.] Raf.) to establish a short juvenile transformation platform for citrus. Sci Hortic. 2009, 119: 335-338.View ArticleGoogle Scholar
  26. Dornelles CMM: Laranja Tobias cultivar promissora para a indústria de sucos. Proceedings of the IV Congresso Brasileiro de Fruticultura: 01-05 March 1977. Edited by: Salvador . 1978, Cruz das Almas: Sociedade Brasileira de Fruticultura, 369-373.Google Scholar
  27. Dutt M, Grosser JW: Evaluation of parameters affecting Agrobacterium-mediated transformation of citrus. Plant Cell Tiss Organ Cult. 2009, 98: 331-340.View ArticleGoogle Scholar
  28. Gutiérrez-E MA, Luth D, Moore GA: Factors affecting Agrobacterium-mediated transformation in Citrus and production of sour orange (Citrus aurantium L.) plants expressing the coat protein gene of citrus tristeza virus. Plant Cell Rep. 1997, 16: 745-753.View ArticleGoogle Scholar
  29. Kaneyoshi J, Kobayashi S, Nakamura Y, Shigemoto N, Doi Y: A simple and efficient gene transfer system of trifoliate orange (Poncirus trifoliata Raf.). Plant Cell Rep. 1994, 13: 541-545.Google Scholar
  30. Boscariol RL, Almeida WAB, Derbyshire MTVC, Mourão Filho FAA, Mendes BMJ: The use of the PMI/mannoses lesion system to recover transgenic sweet orange plants (Citrus sinensis L. Osbeck). Plant Cell Rep. 2003, 22: 122-128.PubMedView ArticleGoogle Scholar
  31. Peña L, Cervera M, Juarez J, Ortega C, Pina JA, Duran-Vila N, Navarro L: High efficiency Agrobacterium mediated transformation and regeneration of citrus. Plant Sci. 1995, 104: 183-191.View ArticleGoogle Scholar
  32. Mason G, Provero P, Vaira AM, Accotto GP: Estimating the number of integrations in transformed plants by quantitative real-time PCR. BMC Biotechnol. 2002, 2: 20-30.PubMedPubMed CentralView ArticleGoogle Scholar
  33. Omar AA, Dekkers MGH, Graham JH, Grosser JW: Estimation of transgene copy number in transformed citrus plants by quantitative multiplex real-time PCR. Biotechnol Prog. 2008, 24: 1241-1248.PubMedView ArticleGoogle Scholar
  34. Donnarumma F, Paffetti D, Fladung M, Biricolti S, Dieter E, Altosaar I, Vettori C: Transgene copy number estimation and analysis of gene expression levels in Populus spp. transgenic lines. BMC Proc. 2011, 5 (7): 152-View ArticleGoogle Scholar
  35. Wen L, Tan B, Guo W: Estimating transgene copy number in precocious trifoliate orange by TaqMan real-time PCR. Plant Cell Tissue Organ Cult. 2012, 109: 363-371.View ArticleGoogle Scholar
  36. Beltrán J, Jaimes H, Echeverry M, Ladino Y, López D, Duque MC, Chavarriaga P, Tohme J: Quantitative analysis of transgenes in cassava plants using real-time PCR technology. In Vitro Cell Dev Biol Plant. 2009, 45: 48-56.View ArticleGoogle Scholar
  37. Hadi F, Salmanian AH, Ghazizadeh E, Amani J, Noghabi KA, Mousavi A: Development of quantitative competitive PCR for determination of copy number and expression level of the synthetic glyphosate oxidoreductase gene in transgenic canola plants. Electron J Biotechnol. 2012, 15 (4): 2-2.Google Scholar
  38. Flavell RB: Inactivation of gene expression in plants as a consequence of specific sequence duplication. Proc Natl Acad Sci USA. 1994, 91: 3490-3496.PubMedPubMed CentralView ArticleGoogle Scholar
  39. Vaucheret H, Nussaume L, Palauqui JC, Quilleré I, Elmayan T: A transcriptionally active state is required for post-transcriptional silencing (co-suppression) of nitrate reductase host genes and transgenes. Plant Cell. 1997, 9: 1495-1504.PubMedPubMed CentralView ArticleGoogle Scholar
  40. Gmitter F, Chen C, Machado MA, Souza AA, Ollitrault P, Froehlicher Y, Shimizu T: Citrus genomics. Tree Genet. Genomes. 2012, 8: 611-626.View ArticleGoogle Scholar
  41. Fujii H, Shimada T, Sugiyama A, Nishikawa F, Endo T, Nakano M, Ikoma Y, Shimizu T, Omura M: Profiling ethylene responsive genes in mature mandarin fruit using a citrus 22 K oligoarray. Plant Sci. 2007, 173: 340-348.View ArticleGoogle Scholar
  42. Terol JM, Naranjo A, Ollitrault P, Talon M: Development of genomic resources for Citrus clementina: characterization of three deep-coverage BAC libraries and analysis of 46,000 BAC end sequences. BMC Genomics. 2008, 9: 423-PubMedPubMed CentralView ArticleGoogle Scholar
  43. Licciardello C, Russo MP, Reforgiato Recupero G, Muccilli V, Cunsolo V, Saletti R, Foti S, Fontanini D: Analysis of Citrus sinensis L. (Osbeck) flesh proteome at maturity time. Acta Hort (ISHS). 2011, 892: 343-349.View ArticleGoogle Scholar
  44. Yun Z, Gao H, Liu P, Liu S, Luo T, Jin S, Xu Q, Xu J, Cheng Y, Deng X: Comparative proteomic and metabolomic profiling of citrus fruit with enhancement of disease resistance by postharvest heat. BMC Plant Biol. 2013, 13: 44-PubMedPubMed CentralView ArticleGoogle Scholar
  45. Kim IJ, Lee J, Han JA, Kim CS, Hur Y: Citrus Lea promoter confers fruit-preferential and stress-inducible gene expression in Arabidopsis. Can J Plant Sci. 2011, 91: 459-466.View ArticleGoogle Scholar
  46. Hood EE, Gelvin SB, Melchers LS, Hoekema A: New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res. 1993, 2: 208-218.View ArticleGoogle Scholar
  47. Brasileiro ACM, de Carneiro VT C: β-Glucuronidase (GUS). Manual de transformação genética de plantas. Edited by: Ana Cristina MR, Vera TCC. 1998, Brasília: EMBRAPA-SPI: EMBRAPA-CENARGEN, 127-139.Google Scholar
  48. Doyle JJ, Doyle JL: Isolation of plant DNA from fresh tissue. Focus. 1990, 12: 13-15.Google Scholar
  49. Rozen S, Skaletsky H: Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000, 132: 365-86.PubMedGoogle Scholar
  50. Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holston T, Gradner J, Wang B, Zhai WX, Zhu LH, Fauquet C, Ronald P: A receptor kinase like protein encoded by the rice disease resistance gene Xa21. Science. 1995, 270: 1804-1806.PubMedView ArticleGoogle Scholar
  51. Wu Z, Burns JK: Isolation and characterization of a cDNA ecoding a lipid transfer protein expressed in ‘Valencia’ orange during abscission. J Exp Bot. 2003, 54: 1183-1191.PubMedView ArticleGoogle Scholar
  52. Tao N, Cheng Y, Xu J, Xu Q, Deng X: An effective protocol for the isolation of RNA from the pulp of ripening citrus fruits. Plant Mol Biol Rep. 2004, 22: 305-View ArticleGoogle Scholar
  53. Pinheiro TT, Litholdo CG, Sereno ML, Leal ML, Albuquerque PSB, Figueira A: Establishing references for gene expression analyses by RT-qPCR in Theobroma cacao tissues. Genet Mol Res. 2011, 10: 3291-305.PubMedView ArticleGoogle Scholar


© Pinheiro et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.
