Patient population
Surgical specimens from 45 patients who had been surgically treated for primary T1G3 bladder tumor with complete transurethral resection at Keio University Hospital from 1993 to 2006 were examined. Patients with an upper urinary tract tumor at the time of diagnosis or incomplete clinical data were excluded from the study. Seventeen patients who did not receive adjuvant BCG treatment were also excluded. The final study sample was composed of 28 patients with T1G3 tumors who had received BCG therapy. The regimen consisted of weekly BCG instillations at a dose of 80 mg for the Tokyo strain, or 81 mg for the Connaught strain, for 6–8 weeks.
Follow-up consisted of cystoscopy with cytology, which was performed every 3 months for the first 2 years, every 6 months for the next 3 years, and annually thereafter. Distant metastasis and upper urinary tract tumor recurrence were evaluated by performing intravenous urography, ultrasonography, or computed tomography scanning. Such evaluations were performed every 1 or 2 years for 5 years after the initial treatment. Recurrence was defined as a new tumor occurring in the bladder, and progression was defined as muscular invasion (stage T2 or higher) or metastatic disease.
The study itself was approved by the Keio University Ethics Committee. All specimens were fixed in 10% formalin and embedded in paraffin, and all slides were re-reviewed by an uropathologist. Tumors were staged according to the American Joint Committee on Cancer–Union Internationale Contre le Cancer TNM classification. Tumor grading was assessed according to the 1998 WHO/International Society of Urology Pathology consensus classification [17]. Lymphovascular invasion was defined as the presence of tumor cells within an endothelium-lined space without underlying muscular walls.
Microdissection of primary tumors
Sections (10-μm thick) were obtained from areas identified as having the highest tumor concentration and then mounted on uncoated glass slides. For histology, representative sections were stained with hematoxylin and eosin according to the standard method. Before microdissection, sections were deparaffinized in xylene for 10 minutes and hydrated with ethanol solutions of 100%, 95%, and finally 70%. Sections were then washed in H2O for 30 seconds, stained with nuclear fast red (NFR, American MasterTech Scientific, Lodi, CA) for 20 seconds, and rinsed again in H2O for 30 seconds. Finally, the samples were dehydrated with ethanol solutions of 70%, 95%, and 100% for 30 seconds each, followed by xylene again for 10 minutes. The slides were then completely air-dried. The sections of interest were selectively isolated by using LCM (P.A.L.M. Microsystem, Leica, Wetzlar, Germany), according to the standard procedure [18]. Cancer cells and cancerous stroma of the sample were dissected by using the LCM technique. At least 25 mm2 of tumor tissue and stromal tissue were collected from each FFPE block.
RNA Extraction and analysis of mRNA level
The dissected tissue samples were transferred to reaction tubes containing 400 μL of 4 M dithiothreitol (DTT)-GITC/sarc (4 M guanidinium isothiocyanate, 50 mM Tris–HCl, 25 mM EDTA) (Invitrogen; No. 15577–018). The blinded tissue samples (400 μL) designated for extraction were placed in a 0.5 mL thin-walled tube. The samples were homogenized and an additional 60 μL of GITC/sarc solution was added. They were heated at 92°C for 30 minutes and then transferred to a 2 mL centrifuge tube. Fifty μL of 2 M sodium acetate, pH 4.0, were added, followed by 600 μL of freshly prepared phenol/chloroform/isoamyl alcohol (250:50:1). The tubes were vortexed for 15 seconds, placed on ice for 15 minutes, and then centrifuged at 13,000 rpm for 8 minutes in a chilled (8°C) centrifuge. The upper aqueous phase was carefully removed and placed in a 1.5 mL centrifuge tube. Glycogen (10 μL) and 300–400 μL of isopropanol were added, and the samples were vortexed for 10–15 seconds. The tubes were chilled at −20°C for 30–45 minutes to precipitate the RNA. The samples were then centrifuged at 13,000 rpm for 7 minutes in an 8°C centrifuge. The supernatant was poured off and 500 μL of 75% ethanol was added. The tubes were again centrifuged at 13,000 rpm for 6 minutes in a chilled (8°C) centrifuge. The supernatant was then carefully poured off, so as not to disturb the RNA pellet, and the samples were quick-spun for another 15 seconds at 13,000 rpm. The remaining ethanol was removed and the samples were left to air-dry for 15 minutes. The pellet was resuspended in 50 μL of 5 mM Tris. Finally, the cDNA was prepared according to the method of Lord and colleagues [19].
Quantification of the 3 genes-of-interest (TS, DPD, and OPRT) as well as an internal reference gene (β-actin) was performed using a fluorescence-based real-time detection method (ABI PRISM 7900 Sequence detection System, TaqMan®, Perkin-Elmer (PE) Applied Biosystem, Foster City, CA). The PCR reaction mixture consisted of 1,200 nM of each primer, 200 nM of probe, 0.4 U of AmpliTaq gold polymerase, 200 nM each of dATP, dCTP, dGTP and dTTP, 3.5 mM of MgCl2 and 1 × Taqman buffer A containing a reference dye. The final volume of the reaction mixture was 20 μL (all reagents were obtained from PE Applied Biosystems, Foster City, CA). Cycling conditions were 50°C for 2 minutes, 95°C for 10 minutes, followed by 46 cycles of 95°C for 15 seconds and 60°C for 1 minute. The following primers and probe sequences were used: TS primers: GCCTCGGTGTGCCTTTCA and CCCGTGATGTGCGCAAT, probe 6FAM (carboxyfluorescein)-TCGCCAGCTACGCCCTGCTCA; DPD primers: AGGACGCAAGGAGGGTTTG and GTCCGCCGAGTCCTTACTGA, probe 6FAM-CAGTGCCTACAGTCTCGAGTCTGCCAGTG; OPRT primers: TAGTGTTTTGGAAACTGTTGAGGTT and CTTGCCTCCCTGCTCTCTGT, probe 6FAM-TGGCATCATTGACCTTCAAGCCCTCCT; β-actin primers: TGAGCGCGGCTACAGCTT and TCCTTAATGTCACGCACGATTT, probe 6FAM-ACCACCACGGCCGAGCGG. TaqMan® measurements yield Ct values that are inversely proportional to the amount of cDNA in the tube. For example, a higher Ct value means that more PCR cycles are required to reach a certain level of cDNA detection. Gene expression values (relative mRNA levels) are expressed as ratios (differences between the Ct values) between the gene of interest and an internal reference gene (β-actin). This reference gene provided the baseline measurement for the amount of RNA isolated from a specimen.
Statistical analysis
All data are presented as the mean ± standard error (SE). Associations between enzymes that regulate the mechanism of 5-FU and clinicopathological features were assessed using the Mann–Whitney U-test or the chi-square test. RFS was estimated using the Kaplan–Meier method, and analyzed with the log-rank test. As described previously [20], continuous pretreatment clinical measurements were analyzed as dichotomous variables according to approximately “optimal” cutpoints as follows. The value that best discriminated between good and poor survival (i.e., which had the most significant P value in a log-rank test) was found by testing all possible cutpoints. All such cutpoints were then rounded to clinically relevant (i.e., convenient) values. The level of statistical significance was set at p < 0.05. These analyses were performed with the SPSS statistical software package, version 16.0 (SPSS: An IBM Company, Chicago, IL).
