Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Research Notes

Open Access

The genetic association study between polymorphisms in uncoupling protein 2 and uncoupling protein 3 and metabolic data in dogs

  • Chihiro Udagawa1,
  • Naomi Tada1,
  • Junzo Asano1,
  • Katsumi Ishioka2,
  • Kazuhiko Ochiai1,
  • Makoto Bonkobara3,
  • Shuichi Tsuchida4 and
  • Toshinori Omi1Email author
BMC Research Notes20147:904

https://doi.org/10.1186/1756-0500-7-904

Received: 26 September 2014

Accepted: 25 November 2014

Published: 11 December 2014

Abstract

Background

The uncoupling proteins (UCPs) in the mitochondrial inner membrane are members of the mitochondrial anion carrier protein family that play an important role in energy homeostasis. Genetic association studies have shown that human UCP2 and UCP3 variants (SNPs and indels) are associated with obesity, insulin resistance, type 2 diabetes mellitus, and metabolic syndrome. The aim of this study was to examine the genetic association between polymorphisms in UCP2 and UCP3 and metabolic data in dogs.

Results

We identified 10 SNPs (9 intronic and 1 exonic) and 4 indels (intronic) in UCP2, and 13 SNPs (11 intronic and 2 exonic) and one indel (exonic) in UCP3, by DNA sequence analysis of 11 different dog breeds (n = 119). An association study between these UCP2 and UCP3 variants and the biochemical parameters of glucose, total cholesterol, lactate dehydrogenase and triglyceride in Labrador Retrievers (n = 50) showed that none of the UCP2 polymorphisms were significantly associated with the levels of these parameters. However, four UCP3 SNPs (intron 1) were significantly associated with total cholesterol levels. In addition, the allele frequencies of two of the four SNPs associated with higher total cholesterol levels in a breed that is susceptible to hypercholesterolemia (Shetland Sheepdogs, n = 30), compared with the control breed (Shiba, n = 30).

Conclusion

The results obtained from a limited number of individuals suggest that the UCP3 gene in dogs may be associated with total cholesterol levels. The examination of larger sample sizes and further analysis will lead to increased precision of these results.

Keywords

DogSNPIndel polymorphismUCP2UCP3Association study

Background

The uncoupling proteins (UCPs) in the mitochondrial inner membrane are members of the mitochondrial anion carrier protein family [1, 2]. Mammals have five UCP homologs, of which UCP1, UCP2, and UCP3 are closely related, while UCP4 and UCP5 are more divergent from the other UCPs [3].

Based on genetic association studies, UCP2, UCP3, or both are reportedly associated with obesity, insulin resistance, type 2 diabetes mellitus, and metabolic syndrome in humans [411]. For example, a SNP in the 5′ untranslated region in human UCP3, the UCP3 -55CT SNP, is known to be a genetic marker associated with mRNA expression [12], elevated high density lipoprotein cholesterol levels, a reduced body mass index (BMI), weight, waist circumference, waist to hip ratio, fat mass, low density lipoprotein (LDL) cholesterol, and total cholesterol (T-Cho) [1315].

The treatment and prevention of obesity and metabolic-related diseases are also clinically important in dogs [1625]. Our previous report showed that the nucleotide sequences, predicted amino acid sequences and the genomic structures of human UCP2 and UCP3 are highly homologous to the canine orthologs [26, 27]. In this study, we investigate whether the dog UCP2 and UCP3 genes are associated with alterations in metabolism.

Results and discussion

Figure 1 shows a schematic representation of the canine UCP2 and UCP3 genes and the identified DNA polymorphisms from 119 animals from 11 breeds. For analysis of the dog UCP2 gene, six regions were individually amplified from genomic DNA and sequenced. We then identified 10 SNPs (9 intronic and 1 exonic) and 4 indels (intronic) in UCP2 (Figure 1, Additional file 1). In the dog UCP3 gene, 13 SNPs (11 intronic and 2 exonic) and 1 indel (exonic) were revealed by sequencing nine regions of this gene (Figure 1, Additional file 1).
Figure 1

Schematic representation of the DNA polymorphisms detected in the UCP2 and UCP3 genes in dog. □: Exon(UTR) ■: Exon(CDS) ▬: Intron │: SNP or INDEL : PCR Fragment. The position of identified DNA polymorphism was numbered from the A of the initiator methionine ATG codon as the +1 revealed in exon. In case of intron, a positive number indicates the number of nucleotides away from the previous exon, while a negative number indicates the number of nucleotide away from the next exon.

To test the association between the dog UCP2 and UCP3 genes and metabolic data, we determined the genotype of 50 Labrador Retrievers for each of 14 polymorphic sites (10 SNPs and 4 indels) in the UCP2 gene, and examined whether any of the genotypes were associated with biochemical measurements of glucose (GLU), total cholesterol (T-Cho), lactate dehydrogenase (LDH), or triglyceride (TG). To exclude any contamination by disease of the animals, we selected Labrador Retrievers that had undergone a health examination for breeding for guide dogs by the Kyushu Guide Dog Association.

The average of measurements was calculated with respect to the genotype group. Nine of the 14 loci in the UCP2 gene were polymorphic in this population of Labrador Retrievers. None of these DNA polymorphisms in the UCP2 gene were significantly associated with any of the biochemical parameters in this study (Additional file 2). We also subjected the 14 polymorphic sites (13 SNPs and 1 indel) in the UCP3 gene to this association analysis. Ten of the 14 sites were polymorphic in this population of Labrador Retrievers. There were no significant differences between genotype and GLU, LDH, or TG measurements for any polymorphic site. However, the T-Cho levels differed significantly among the genotype groups at four sites: -4399C/T, -4339T/C, -930T/C and -803C/T in intron 1 of the UCP3 gene (UCP 3 intron1). The average T-Cho levels in dogs carrying CC or CT at -4399 C/T were 273.5 ± 49.0 and 237.2 ± 53.3, respectively. The average T-Cho levels for the TT, TC, or CC genotypes at -4339T/C and -930T/C were 264.3 ± 49.6, 276.9 ± 49.5, and 233.5 ± 51.2, respectively. Those for CC or CT at -803C/T were 271.6 ± 49.5 and 239.1 ± 54.5, respectively (Table 1). The genotype distributions were in a Hardy–Weinberg equilibrium.
Table 1

Association analysis of UCP3 DNA polymorphisms with biochemical parameters among healthy Labrador Retrievers

DNA polymorphism

Genotype

GLU

T-Cho

LDH

TG

UCP3

CC (34)

97.1 ± 8.4

273.5 ± 49.0

55.9 ± 18.0

44.8 ± 21.1

-4399C/T

CT (16)

98.8 ± 14.5

237.2 ± 53.3

55.7 ± 13.5

49.4 ± 24.8

 

TT (0)

-

-

-

-

 

CC vs CT + TT

0.597

0.021 *

0.965

0.504

UCP3

TT (8)

94.5 ± 5.4

264.3 ± 49.6

55.3 ± 13.7

40.0 ± 13.5

-4339T/C

TC (27)

96.3 ± 11.5

276.9 ± 49.5

58.2 ± 20.9

50.4 ± 24.8

 

CC (15)

101.7 ± 10.4

233.5 ± 51.2

51.9 ± 5.3

42.3 ± 20.5

 

TT vs TC + CC

0.366

0.890

0.914

0.388

 

TT + TC vs CC

0.079

0.011*

0.279

0.408

UCP3

CC (15)

94.4 ± 11.9

255.5 ± 52.6

56.9 ± 16.1

51.2 ± 23.2

-4010C/T

CT (29)

98.7 ± 10.2

270.2 ± 52.2

56.5 ± 18.5

43.2 ± 21.5

 

TT (6)

100.7 ± 8.6

237.7 ± 54.7

50.0 ± 0.0

48.7 ± 24.6

 

CC vs CT + TT

0.159

0.580

0.763

0.310

 

CC + CT vs TT

0.462

0.234

0.362

0.782

UCP3

TT (8)

94.5 ± 5.4

264.3 ± 49.6

55.3 ± 13.7

40.0 ± 13.5

-930T/C

TC (27)

96.3 ± 11.5

276.9 ± 49.5

58.2 ± 20.9

50.4 ± 24.8

 

CC (15)

101.7 ± 10.4

233.5 ± 51.2

51.9 ± 5.3

42.3 ± 20.5

 

TT vs TC + CC

0.366

0.890

0.914

0.388

 

TT + TC vs CC

0.079

0.011*

0.279

0.408

UCP3

CC (35)

96.9 ± 8.4

271.6 ± 49.5

55.7 ± 17.7

44.5 ± 20.9

-803C/T

CT (15)

99.5 ± 14.8

239.1 ± 54.5

56.1 ± 13.9

50.5 ± 25.2

 

TT (0)

-

-

-

-

 

CC vs CT + TT

0.431

0.045*

0.950

0.388

UCP3

TT (15)

94.4 ± 11.9

255.5 ± 52.6

56.9 ± 16.1

51.2 ± 23.2

IVS3+26T/C

TC (29)

98.7 ± 10.2

270.2 ± 52.2

56.5 ± 18.5

43.2 ± 21.5

 

CC (6)

100.7 ± 8.6

237.7 ± 54.7

50.0 ± 0.0

48.7 ± 24.6

 

TT vs TC + CC

0.159

0.580

0.763

0.310

 

TT + TC vs CC

0.462

0.234

0.362

0.782

UCP3

GG (15)

94.4 ± 11.9

255.5 ± 52.6

56.9 ± 16.1

51.2 ± 23.2

IVS3+69G/A

GA (29)

98.7 ± 10.2

270.2 ± 52.2

56.5 ± 18.5

43.2 ± 21.5

 

AA (6)

100.7 ± 8.6

237.7 ± 54.7

50.0 ± 0.0

48.7 ± 24.6

 

GG vs GA + AA

0.159

0.580

0.763

0.310

 

GG + GA vs AA

0.462

0.234

0.362

0.782

UCP3

GG (15)

94.4 ± 11.9

255.5 ± 52.6

56.9 ± 16.1

51.2 ± 23.2

IVS5-115G/C

GC (29)

98.7 ± 10.2

270.2 ± 52.2

56.5 ± 18.5

43.2 ± 21.5

 

CC (6)

100.7 ± 8.6

237.7 ± 54.7

50.0 ± 0.0

48.7 ± 24.6

 

GG vs GC + CC

0.159

0.580

0.763

0.310

 

GG + GC vs CC

0.462

0.234

0.362

0.782

UCP3

TT (15)

94.4 ± 11.9

255.5 ± 52.6

56.9 ± 16.1

51.2 ± 23.2

IVS5-100T/C

TC (29)

98.7 ± 10.2

270.2 ± 52.2

56.5 ± 18.5

43.2 ± 21.5

 

CC (6)

100.7 ± 8.6

237.7 ± 54.7

50.0 ± 0.0

48.7 ± 24.6

 

TT vs TC + CC

0.159

0.580

0.763

0.310

 

TT + TC vs CC

0.462

0.234

0.362

0.782

UCP3

II (15)

94.4 ± 11.9

255.5 ± 52.6

56.9 ± 16.1

51.2 ± 23.2

1106delAAG

ID (29)

98.7 ± 10.2

270.2 ± 52.2

56.5 ± 18.5

43.2 ± 21.5

 

DD (6)

100.7 ± 8.6

237.7 ± 54.7

50.0 ± 0.0

48.7 ± 24.6

 

II vs ID + DD

0.159

0.580

0.763

0.310

 

II + ID vs DD

0.462

0.234

0.362

0.782

Data are expressed as the mean ± SD.

p-values were calculated by ANOVA. * and bold: p < 0.05.

I: insertion, D: deletion, IVS: intervening sequence.

Loci which were not observed polymorphism in Labrador retriever, or were not detected p-value are not shown.

Shetland Sheepdogs are considered to have a predisposition to primary hyperlipidemia as determined by the levels of cholesterol, triglycerides, and free fatty acids [28, 29]. Therefore, we investigated the distribution of genotypes for SNPs and indels of the UCP2 and UCP3 genes in a population of Shetland Sheepdogs (n = 30). Shiba (n = 30) were also tested as a comparative contrast breed in this study. Statistically significant differences in allele frequency between the two breeds were found in five of the 14 polymorphic sites in UCP2 (-3629C/G, -2931A/T, -748G/A, -636A/G and IVS6-133delTCTCCCC, Additional file 3). Four SNPs (-4339T/C, -930T/C, 143A/C and IVS3+121T/C) of the 14 UCP3 polymorphic sites were significantly different in allele frequency between the two breeds (Table 2). Despite the different genetic background in each of the dog breeds [3032], the different allele frequencies in the UCP2 and UCP3 polymorphic site between the two breeds may result from the susceptibility of Shetland Sheepdogs to hypercholesterolemia in a limited number of individuals.
Table 2

Genotyping data and interbreed analysis of DNA polymorphisms in UCP3

UCP3 DNA polymorphism

Genotype

Number of samples

  

Allele frequency

Shiba

Shetland sheepdog

p

Allele

Shiba

Shetland sheepdog

-4399C/T

CC

29

30

NS

C

0.98

1.00

 

CT

1

0

CC vs CT + TT

T

0.02

0.00

 

TT

0

0

   

-4339T/C

TT

0

4

p < 0.05

T

0.07

0.37

 

TC

4

14

TT + TC vs CC

C

0.93

0.63

 

CC

26

12

   

-4160G/A

GG

30

30

ND

G

1.00

1.00

 

GA

0

0

A

0.00

0.00

 

AA

0

0

   

-4010C/T

CC

18

13

NS

C

0.75

0.70

 

CT

9

16

CC vs CT + TT

T

0.25

0.30

 

TT

3

1

   

-930T/C

TT

0

4

p < 0.05

T

0.07

0.37

 

TC

4

14

TT + TC vs CC

C

0.93

0.63

 

CC

26

12

   

-803C/T

CC

30

30

ND

C

1.00

1.00

 

CT

0

0

T

0.00

0.00

 

TT

0

0

   

143A/C

AA

20

30

p < 0.05

A

0.82

1.00

 

AC

9

0

AA vs AC + CC

C

0.18

0.00

 

CC

1

0

   

IVS3+26T/C

TT

10

13

NS

T

0.57

0.70

 

TC

14

16

TT vs TC + CC

C

0.43

0.30

 

CC

6

1

   

IVS3+69G/A

GG

18

13

NS

G

0.75

0.70

 

GA

9

16

GG vs GA + AA

A

0.25

0.30

 

AA

3

1

   

IVS3+121T/C

TT

29

14

p < 0.05

T

0.98

0.67

 

TC

1

12

TT vs TC + CC

C

0.02

0.33

 

CC

0

4

   

IVS5-115G/C

GG

10

4

NS

G

0.55

0.37

 

GC

13

14

GG + GC vs CC

C

0.45

0.63

 

CC

7

12

   

IVS5-100T/C

TT

18

13

NS

T

0.75

0.70

 

TC

9

16

TT vs TC + CC

C

0.25

0.30

 

CC

3

1

   

838T/C

TT

28

30

NS

T

0.97

1.00

 

TC

2

0

TT vs TC + CC

C

0.03

0.00

 

CC

0

0

   

1106delAAG

ins ins

18

13

NS

ins

0.75

0.70

 

ins del

9

16

II vs ID + DD

del

0.25

0.30

 

del del

3

1

   

I: insertion, D: deletion. IVS: intervening sequence.

p-values were calculated by Fisher’s exact test. p < 0.05 NS:not significance. ND: not detection.

The T allele at -4339T/C and -930T/C located in the UCP3 intron 1 is associated with higher T-Cho levels, as shown by two different experiments: the association between polymorphisms and metabolic data (Table 1), and the distribution of allele of genotype in the breed that is susceptible to hypercholesterolemia (Table 2). These results suggest that the dog UCP3 gene might be associated with T-Cho levels in a limited number of individuals.

It is known that the peroxisome proliferator activated receptors (PPAR) ligands activate UCP3 expression [33, 34]. The UCP3 intron 1 contains that the putative binding elements of MyoG/MyoD, PPARγ/RXRα and SP1/SP3 that enhanced the UCP3 gene transcription mainly regulated by PPARs in hamster, rat, and mouse [33]. Recently, we find the similar nucleotide sequences of the PPARγ/RXRα element in the dog UCP3 intron 1 (Canine Genome Draft, NC_006603.3). These findings imply that the dog UCP3 intron 1 may be associated with regulation of UCP3 gene expression. Further studies will be needed to demonstrate whether PPAR ligands bind or not this intronic region in dog.

With each genetic study, a different sample size is used to identify the candidate gene associating with genotypes and phenotypes in common diseases (multifactorial diseases) and/or single gene disorders. For instance, genome-wide association studies (GWAS) have reported the candidate gene associated with a mild form of disproportionate dwarfism using 23 cases and 37 controls [35], atopic dermatitis using 91 cases and 88 controls [36], and the chromosomal region of Patellar Luxation using 45 cases and 40 controls [37]. Some of the candidate genes were also tested using more than a hundred samples. The examination of larger sample sizes and further analysis will lead to increased precision of our results. In addition, because the association analysis in this study was performed using only polymorphisms within the UCP2 and UCP3 genes, we cannot exclude the possibility that a gene that is closely linked to UCP3 is causal.

Conclusions

A genetic association study between polymorphisms in the dog uncoupling protein 2 and 3 genes and metabolic data showed that the SNPs of the UCP3 intron 1 were associated with T-Cho levels in Labrador Retrievers. Alleles associated with high T-Cho levels of these polymorphisms were also present at higher frequencies in a breed that is susceptible to hypercholesterolemia (Shetland Sheepdogs), than in the control group (Shiba). The results obtained from a limited number of individuals suggest that the UCP3 gene in dogs may be associated with total cholesterol levels. Therefore, the UCP3 gene could be an interesting target, not only for lipid metabolism, but also for the treatment and prevention of obesity and metabolic-related diseases in dogs.

Methods

Animals and DNA

All animal experiments were approved by The Experimental Animal Ethics Committee in Nippon Veterinary and Life Science University. The blood samples were originally collected at the Veterinary Medical Teaching Hospital at NVLU with the written consent of each owner or the Kyushu Guide Dog Association. The collection of samples was handled by licensed veterinarians only.

Panel 1, for the first SNP discovery, was collected from 11 dogs that represented 11 different breeds: Miniature Dachshund, Welsh Corgi, Labrador Retriever, Shetland Sheepdog, Beagle, Yorkshire Terrier, Dobermann, Whippet, Weimaraner, Papillon, and Shiba. Panel 2 was used for SNP discovery and a study of associations between SNP variants and biochemical parameters; these samples were collected from 50 Labrador Retrievers. Panel 3 was used for SNP discovery and an interbreed analysis was collected from 30 Shetland Sheepdogs and 30 Shibas containing each one animals from Panel 1. A list of breeds and number of individuals are presented in Table 3. Genomic DNA was extracted from whole blood with the Puregene kit (Qiagen, Valencia CA, USA).
Table 3

List of 119 DNA samples from 11 breeds

DNA samples

Breeds

N

Sex

Male

Female

Panel 1a

Miniature Dachshund

1

 

1

 

Welsh Corgi

1

1

 
 

Labrador Retriever

1

1

 
 

Shetland Sheepdog

1

1

 
 

Beagle

1

 

1

 

Yorkshire Terrier

1

1

 
 

Dobermann

1

 

1

 

Whippet

1

 

1

 

Weimaraner

1

 

1

 

Papillon

1

 

1

 

Shiba

1

1

 

Panel 2a,b,d

Labrador Retriever

50

27

23

Panel 3a,b,c

Shetland Sheepdog

30e

15

15

 

Shiba

30e

15

15

Total

 

119f

60

59

N. Number of samples.

a. SNP discovery.

b.SNP genotyping.

c. Interbreed analysis.

d. Association analysis of DNA polymorphisms with biochemical parameters.

e. Include one individual of panel 1.

f. Total numbers of independent individuals.

PCR

We used sequences of UCP2 and UCP3 (Canine Genome Draft, NC_006603.3), to design 15 pairs of primers for amplification of each exon of the UCP2 and UCP3 genes (Table 4). Each PCR using TaKaRa Ex Taq was performed in a total volume of 25 μl and contained 20 ng genomic DNA, 2.5 μl 10× Ex Taq Buffer (including 20 mM Tris–HCl, 100 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5% Tween 20, 0.5% Nonidet P-40, 50% Glycerol, 20 mM Mg2+), 0.4 mM of each primer, 200 μM dNTP (dATP, dTTP, dCTP and dGTP), and 1U TaKaRa Ex Taq (TaKaRa, Shiga, Japan). Each PCR using FastStart Taq DNA polymerase (Roche, Basel, Switzerland)) was performed in a total volume of 25 μl and contained 20 ng genomic DNA, 2.5 μl 10× reaction Buffer (including 500 mM Tris–HCl, 100 mM KCl, 50 mM (NH4)2SO4, 20 mM MgCl2), 0.4 mM of each primer (F12: 0.2 mM of each primer), 200 μM dNTP (dATP, dTTP, dCTP and dGTP), and 1U FastStart Taq DNA polymerase. If necessary, we used FastStart Taq for primer pairs that did not work with TaKaRa Ex Taq. The PCR reactions were performed on TaKaRa PCR Thermal Cycler Dice TP600 (TaKaRa). The conditions for PCR are shown in Table 5.
Table 4

Sequences of primers for PCR

Gene

Fragment

Primer

Primer sequences

Range of PCR amplificationa

size

Regionb

(5’-3’)

(bp)

UCP2

F1

UCP2F1-F

CAGCTCTCGGCTTGTGAGC

24304468-24305048

581

Exon 1, Intron 1

 

UCP2F1-R

CACAACAGTCAGCAGACTGG

 

F2

UCP2F2-F

CCTTGCTGGAGTGTAATCTG

24305288-24306125

838

Intron 1, Exon 2, Intron 2

 

UCP2F2-R

TGGGTTTGCCCAGGTCTTTC

 

F3

UCP2F3-F

TACCAACTCTTCCATACCTC

24307315-24308410

1096

Intron 2, Exon 3

 

UCP2F3-R

ATGCAGGCAGCTGTGCCAG

 

F4

UCP2F4-F

TGAGCAGGACAGGACTGTT

24308186-24308944

759

Exon 3, Intron 3, Exon 4, Intron 4

 

UCP2F4-R

AAAGGAGCTATACAGCAAATCA

 

F5

UCP2F5-F

TCTCAGAGCATTTACTCTGCT

24309392-24310367

976

Intron 4, Exon 5, Intron 5, Exon 6, Intron 6

 

UCP2F5-R

AGAAAAGGCAGTCAGGACTC

 

F6

UCP2F6-F

TCCTCCCCCTCAAACCATCA

24310274-24311183

910

Intron 6, Exon 7, Intron 7, Exon 8

 

UCP2F6-R

GAAAGGGAGGTGGTGGGAA

UCP3

F7

UCP3F7-F

ATAGTACTTACCTCATAGGGT

24277647-24278722

1076

5’Fl, Exon 1, Intron 1

 

UCP3F7-R

TATCTGTTCTCCATGGCAGC

 

F8

UCP3F8-F

CTAAGGAGCCTTAAGGGAAC

24278114-24278825

712

Exon 1, Intron 1

 

UCP3F8-R

TTCAGGGAGAGCTCAGGATC

 

F9

UCP3F9-F

ACGCTACAGGTATGTGTGAG

24281537-24282266

730

Intron 1

 

UCP3F9-R

CCTGAAGTGTACAGAGAGCC

 

F10

UCP3F10-F

TAACTAACAGTTTAGGTGAGTC

24282174-24282933

760

Intron 1, Exon 2, Intron 2

 

UCP3F10-R

TGCTCAGAGTTCTGTGTGAAG

 

F11

UCP3F11-F

CAGGTCCTTCTGCACCCAG

24283244-24284111

868

Intron 2, Exon 3, Intron 3, Exon 4, Intron 4

 

UCP3F11-R

TCATTCTGGGAGTTCCCTCC

 

F12

UCP3F12-F

CCTGTGGCCTTGCAACCAGA

24285138-24285396

259

Intron 4, Exon 5, Intron 5

 

UCP3F12-R

TGTTACCTCTGAGTGGTGCC

 

F13

UCP3F13-F

GGCACCACTCAGAGGTAACA

24285377-24286088

712

Intron 5, Exon 6, Intron 6

 

UCP3F13-R

TGGGAAGGGATGTTGGATGC

 

F14

UCP3F14-F

GCACTATCGTTACACTCAAGG

24285748-24286088

341

Intron 5, Exon 6, Intron 6

 

UCP3F14-R

TGGGAAGGGATGTTGGATGC

 

F15

UCP3F15-F

TAACTGCCTAACACAGAACC

24288288-24289004

717

Intron 6, Exon 7

 

UCP3F15-R

TTCAGCCTTTCCTGTACACA

a. Number of nucleotide position is from canine genome draft (CGD) NC_006603.3.

b. Fl: Flanking region Start codon is located in Exon 3 in UCP2 and Exon 2 in UCP3. Stop codon is located in Exon 8 in UCP2 and Exon 7 in UCP3.

Table 5

Conditions for PCR

Fragment

Taqa

Initial denature (°C/m)b

Denature (°C/m)b

Annealing (°C/s)b

Extention (°C/m)b

Cycle

Final extention (°C/m)b

F1

F

95/4

95/1

57/30

72/1

35

72/7

F2

E

95/1

95/1

60/30

72/1

35

72/7

F3

F

95/4

95/1

60/10

72/1

30

72/7

F4

E

95/1

95/1

60/30

72/1

35

72/7

F5

F

95/4

95/1

60/30

72/1

35

72/7

F6

E

95/1

95/1

62/30

72/1

35

72/7

F7

E

95/1

95/1

60/15

72/1

34

72/7

F8

F

95/4

95/1

62/30

72/1

35

72/7

F9

F

95/4

95/1

62/30

72/1

35

72/7

F10

E

95/1

95/1

60/30

72/1

35

72/7

F11

F

95/4

95/1

62/15

72/1

32

72/7

F12

E

95/1

95/1

60/30

72/1

35

72/7

F13

E

95/1

95/1

60/30

72/1

35

72/7

F14

E

95/1

95/1

60/30

72/1

35

72/7

F15

E

95/1

95/1

60/30

72/1

35

72/7

a. Taq polymerase: E = ExTaq (TaKaRa), F = Fast start Taq (Roche).

b. m: minutes s: seconds.

Sequencing and SNP detection

The PCR products were purified with High Pure PCR Product Purification Kit (Roche). Cycle sequencing was then performed with the Big Dye Terminator v3.1 kit (Applied Biosystems, Foster City CA, USA); each reaction was run in a 10 μl reaction volume containing 1 μl purified PCR amplification product, 1 μl Ready Reaction Premix, 1.5 μl 5× Big Dye Sequence Buffer, 1 μl primer (1.6 pmol/μl), and 5.5 μl sterile water. Cycle sequencing reactions were performed with the following conditions: 60 s at 96°C followed by 25 cycles of 10 s at 96°C, 5 s at 50°C and 4 min at 60°C. BigDye Xterminator Purification kits were used according to the manufacturer’s instructions (Applied Biosystems) to purify dye-labeled fragments. Samples were analyzed on an ABI PRISM 310 genetic analyzer (Applied Biosystems). We identified DNA polymorphisms by comparing each sequence with the reference sequence (Canine Genome Draft. NC_006603.3) by BLAST in NCBI (National Center for Biotechnology Information) and GENETYX program Ver. 11(GENETYX Corporation, Tokyo, Japan). The position of identified DNA polymorphism was numbered from the A of the initiator methionine ATG codon as the +1 revealed in exon. In case of intron, a positive number indicates the number of nucleotides away from the previous exon, while a negative number indicates the number of nucleotide away from the next exon.

Measurement of biochemical parameters

Blood samples were collected into heparinized plastic tubes at least 12 h postprandial. Plasma was separated by centrifugation at 1500× g for 10 min. Glucose (GLU), triglyceride (TG), total cholesterol (T-Cho), and lactate dehydrogenase (LDH) were measured using a Spotchem EM SP-4430 (Arkray, Kyoto, Japan) with the manufacturer’s reagents.

Statistical analysis

Deviation from the Hardy–Weinberg equilibrium was assessed by the Chi-squared test. SNPAlyze (Dynacom, Chiba, Japan) was used to estimate haplotype frequencies. Genotype frequencies were compared using the Fisher’s exact test. Differences of p < 0.05 were considered statistically significant. Associations between genotype frequencies and metabolic data were analyzed by one-way analysis of variance (ANOVA).

Declarations

Acknowledgement

We are thankful to the Department of Veterinary Clinical Pathology and the medical staff at Nippon Veterinary and Life Science University (NVLU) in Musashino Tokyo, and to the Kyushu Guide Dog Association in Itoshima, Fukuoka for biological samples.

Authors’ Affiliations

(1)
Department of Basic Science, School of Veterinary Nursing and Technology, Faculty of Veterinary Science, Nippon Veterinary and Life Science University
(2)
Department of Veterinary Nursing, School of Veterinary Nursing and Technology, Faculty of Veterinary Science, Nippon Veterinary and Life Science University
(3)
Department of Veterinary Clinical Pathology, Nippon Veterinary and Life Science University
(4)
Laboratory of Comparative Cellular Biology, Nippon Veterinary and Life Science University

References

  1. Nicholls DG, Locke RM: Thermogenic mechanisms in brown fat. Physiol Rev. 1984, 64: 1-64.PubMedGoogle Scholar
  2. Boss O, Muzzin P, Giacobino JP: The uncoupling proteins, a review. Eur J Endocrinol. 1998, 139: 1-9. 10.1530/eje.0.1390001.PubMedView ArticleGoogle Scholar
  3. Ricquier D, Bouillaud F: The uncoupling protein homologues: UCP1, UCP2, UCP3, StUCP and AtUCP. Biochem J. 2000, 345: 161-179. 10.1042/0264-6021:3450161.PubMedPubMed CentralView ArticleGoogle Scholar
  4. Schrauwen P, Walder K, Ravussin E: Human uncoupling proteins and obesity. Obes Res. 1999, 7: 97-105. 10.1002/j.1550-8528.1999.tb00396.x.PubMedView ArticleGoogle Scholar
  5. Kagawa Y, Yanagisawa Y, Hasegawa K, Suzuki H, Yasuda K, Kudo H, Abe M, Matsuda S, Ishikawa Y, Tsuchiya N, Sato A, Umetsu K, Kagawa Y: Single nucleotide polymorphisms of thrifty genes for energy metabolism: evolutionary origins and prospects for intervention to prevent obesity-related diseases. Biochem Biophys Res Commun. 2002, 295: 207-222. 10.1016/S0006-291X(02)00680-0.PubMedView ArticleGoogle Scholar
  6. Reis AF, Dubois-Laforgue D, Bellanné-Chantelot C, Timsit J, Velho G: A polymorphism in the promoter of UCP2 gene modulates lipid levels in patients with type 2 diabetes. Mol Genet Metab. 2004, 82: 339-344. 10.1016/j.ymgme.2004.06.008.PubMedView ArticleGoogle Scholar
  7. Yoon Y, Park BL, Cha MH, Kim KS, Cheong HS, Choi YH, Shin HD: Effects of genetic polymorphisms of UCP2 and UCP3 on very low calorie diet-induced body fat reduction in Korean female subjects. Biochem Biophys Res Commun. 2007, 359: 451-456. 10.1016/j.bbrc.2007.05.110.PubMedView ArticleGoogle Scholar
  8. Chan CB, Harper ME: Uncoupling proteins: role in insulin resistance and insulin insufficiency. Curr Diabetes Rev. 2006, 2: 271-283. 10.2174/157339906777950660.PubMedPubMed CentralView ArticleGoogle Scholar
  9. Lee HJ, Ryu HJ, Shin HD, Park BL, Kim JY, Cho YM, Park KS, Song J, Oh B: Associations between polymorphisms in the mitochondrial uncoupling proteins (UCPs) with T2DM. Clin Chim Acta. 2008, 398: 27-33. 10.1016/j.cca.2008.07.029.PubMedView ArticleGoogle Scholar
  10. Oktavianthi S, Trimarsanto H, Febinia CA, Suastika K, Saraswati MR, Dwipayana P, Arindrarto W, Sudoyo H, Malik SG: Uncoupling protein 2 gene polymorphisms are associated with obesity. Cardiovasc Diabetol. 2012, 11: 41-10.1186/1475-2840-11-41.PubMedPubMed CentralView ArticleGoogle Scholar
  11. De Souza BM, Brondani LA, Bouças AP, Sortica DA, Kramer CK, Canani LH, Leitão CB, Crispim D: Associations between UCP1–3826A/G, UCP2–866G/A, Ala55Val and Ins/Del, and UCP3–55C/T polymorphisms and susceptibility to type 2 diabetes mellitus: case–control study and meta-analysis. PLoS One. 2013, 8: e54259-10.1371/journal.pone.0054259.PubMedPubMed CentralView ArticleGoogle Scholar
  12. Schrauwen P, Xia J, Walder K, Snitker S, Ravussin E: A novel polymorphism in the proximal UCP3 promoter region: effect on skeletal muscle UCP3 mRNA expression and obesity in male non-diabetic Pima Indians. Int J Obes Relat Metab Disord. 1999, 23: 1242-1245.PubMedView ArticleGoogle Scholar
  13. Hamada T, Kotani K, Fujiwara S, Sano Y, Domichi M, Tsuzaki K, Sakane N: The common -55 C/T polymorphism in the promoter region of the uncoupling protein 3 gene reduces prevalence of obesity and elevates serum high-density lipoprotein cholesterol levels in the general Japanese population. Metabolism. 2008, 57: 410-415. 10.1016/j.metabol.2007.10.019.PubMedView ArticleGoogle Scholar
  14. De Luis DA, Aller R, Izaola O, De La Fuente B, Conde R, Eiros Bouza JM: Relation of -55CT polymorphism of UCP3 gene with weight loss and metabolic changes after a high monounsaturated fat diet in obese non diabetic patients. Eur Rev Med Pharmacol Sci. 2013, 17: 2810-2815.PubMedGoogle Scholar
  15. Salopuro T, Pulkkinen L, Lindström J, Kolehmainen M, Tolppanen AM, Eriksson JG, Valle TT, Aunola S, Ilanne-Parikka P, Keinänen-Kiukaanniemi S, Tuomilehto J, Laakso M, Uusitupa M: Variation in the UCP2 and UCP3 genes associates with abdominal obesity and serum lipids: the Finnish Diabetes Prevention Study. BMC Med Genet. 2009, 10: 94-10.1186/1471-2350-10-94.PubMedPubMed CentralView ArticleGoogle Scholar
  16. Edney AT, Smith PM: Study of obesity in dogs visiting veterinary practices in the United Kingdom. Vet Rec. 1986, 118: 391-396. 10.1136/vr.118.14.391.PubMedView ArticleGoogle Scholar
  17. Jeusette IC, Lhoest ET, Istasse LP, Diez MO: Influence of obesity on plasma lipid and lipoprotein concentrations in dogs. Am J Vet Res. 2005, 66: 81-86. 10.2460/ajvr.2005.66.81.PubMedView ArticleGoogle Scholar
  18. Laflamme DP: Understanding and managing obesity in dogs and cats. Vet Clin North Am Small Anim Pract. 2006, 36: 1283-1295. 10.1016/j.cvsm.2006.08.005.PubMedView ArticleGoogle Scholar
  19. Ishioka K, Omachi A, Sagawa M, Shibata H, Honjoh T, Kimura K, Saito M: Canine adiponectin: cDNA structure, mRNA expression in adipose tissues and reduced plasma levels in obesity. Res Vet Sci. 2006, 80: 127-132. 10.1016/j.rvsc.2005.05.011.PubMedView ArticleGoogle Scholar
  20. German AJ, Hervera M, Hunter L, Holden SL, Morris PJ, Biourge V, Trayhurn P: Improvement in insulin resistance and reduction in plasma inflammatory adipokines after weight loss in obese dogs. Domest Anim Endocrinol. 2009, 37: 214-226. 10.1016/j.domaniend.2009.07.001.PubMedView ArticleGoogle Scholar
  21. Zoran DL: Obesity in dogs and cats: a metabolic and endocrine disorder. Vet Clin North Am Small Anim Pract. 2010, 40: 221-239. 10.1016/j.cvsm.2009.10.009.PubMedView ArticleGoogle Scholar
  22. Tvarijonaviciute A, Ceron JJ, Holden SL, Cuthbertson DJ, Biourge V, Morris PJ, German AJ: Obesity-related metabolic dysfunction in dogs: a comparison with human metabolic syndrome. BMC Vet Res. 2012, 8: 147-10.1186/1746-6148-8-147.PubMedPubMed CentralView ArticleGoogle Scholar
  23. Axelsson E, Ratnakumar A, Arendt ML, Maqbool K, Webster MT, Perloski M, Liberg O, Arnemo JM, Hedhammar A, Lindblad-Toh K: The genomic signature of dog domestication reveals adaptation to a starch-rich diet. Nature. 2013, 495: 360-364. 10.1038/nature11837.PubMedView ArticleGoogle Scholar
  24. Park HJ, Lee SE, Oh JH, Seo KW, Song KH: Leptin, adiponectin and serotonin levels in lean and obese dogs. BMC Vet Res. 2014, 10: 113-10.1186/1746-6148-10-113.PubMedPubMed CentralView ArticleGoogle Scholar
  25. Kawasumi K, Kashiwado N, Okada Y, Sawamura M, Sasaki Y, Iwazaki E, Mori N, Yamamoto I, Arai T: Age effects on plasma cholesterol and triglyceride profiles and metabolite concentrations in dogs. BMC Vet Res. 2014, 10: 57-10.1186/1746-6148-10-57.PubMedPubMed CentralView ArticleGoogle Scholar
  26. Ishioka K, Kanehira K, Sasaki N, Kitamura H, Kimura K, Saito M: Canine mitochondrial uncoupling proteins: structure and mRNA expression of three isoforms in adult beagles. Comp Biochem Physiol B Biochem Mol Biol. 2002, 131: 483-489. 10.1016/S1096-4959(02)00004-0.PubMedView ArticleGoogle Scholar
  27. Udagawa C, Chong YH, Shito M, Kawakami T, Tada N, Ochiai K, Ishioka K, Tsuchida S, Omi T: cDNA cloning and expression analysis of canine uncoupling protein 2 and 3 genes. J Pet Anim Nutr. 2011, 14: 68-75.Google Scholar
  28. Sato K, Agoh H, Kaneshige T, Hikasa Y, Kagota K: Hypercholesterolemia in Shetland sheepdogs. J Vet Med Sci. 2000, 62: 1297-1301. 10.1292/jvms.62.1297.PubMedView ArticleGoogle Scholar
  29. Mori N, Lee P, Muranaka S, Sagara F, Takemitsu H, Nishiyama Y, Yamamoto I, Yagishita M, Arai T: Predisposition for primary hyperlipidemia in Miniature Schnauzers and Shetland sheepdogs as compared to other canine breeds. Res Vet Sci. 2010, 88: 394-399. 10.1016/j.rvsc.2009.12.003.PubMedView ArticleGoogle Scholar
  30. American Kennel Club Home Page.http://www.akc.org/breeds/shiba_inu/index.cfm,
  31. Sugiyama S, Chong YH, Shito M, Kasuga M, Kawakami T, Udagawa C, Aoki H, Bonkobara M, Tsuchida S, Sakamoto A, Okuda H, Nagai A, Omi T: Analysis of mitochondrial DNA HVR1 haplotype of pure-bred domestic dogs in Japan. Leg Med (Tokyo). 2013, 15: 303-309. 10.1016/j.legalmed.2013.08.005.View ArticleGoogle Scholar
  32. Parker HG, Kim LV, Sutter NB, Carlson S, Lorentzen TD, Malek TB, Johnson GS, DeFrance HB, Ostrander EA, Kruglyak L: Genetic structure of the purebred domestic dog. Science. 2004, 304: 1160-1164. 10.1126/science.1097406.PubMedView ArticleGoogle Scholar
  33. Hoffmann C, Zimmermann A, Hinney A, Volckmar AL, Jarrett HW, Fromme T, Klingenspor M: A novel SP1/SP3 dependent intronic enhancer governing transcription of the UCP3 gene in brown adipocytes. PLoS One. 2013, 8: e83426-10.1371/journal.pone.0083426.PubMedPubMed CentralView ArticleGoogle Scholar
  34. Villarroya F, Iglesias R, Giralt M: PPARs in the Control of Uncoupling Proteins Gene Expression. PPAR Res. 2007, 2007: 74364-PubMedPubMed CentralView ArticleGoogle Scholar
  35. Frischknecht M, Niehof-Oellers H, Jagannathan V, Owczarek-Lipska M, Drögemüller C, Dietschi E, Dolf G, Tellhelm B, Lang J, Tiira K, Lohi H, Leeb T: A COL11A2 mutation in Labrador retrievers with mild disproportionate dwarfism. PLoS One. 2013, 8: e60149-10.1371/journal.pone.0060149.PubMedPubMed CentralView ArticleGoogle Scholar
  36. Tengvall K, Kierczak M, Bergvall K, Olsson M, Frankowiack M, Farias FH, Pielberg G, Carlborg Ö, Leeb T, Andersson G, Hammarström L, Hedhammar Å, Lindblad-Toh K: Genome-wide analysis in German shepherd dogs reveals association of a locus on CFA 27 with atopic dermatitis. PLoS Genet. 2013, 9: e1003475-10.1371/journal.pgen.1003475.PubMedPubMed CentralView ArticleGoogle Scholar
  37. Lavrijsen IC, Leegwater PA, Wangdee C, van Steenbeek FG, Schwencke M, Breur GJ, Meutstege FJ, Nijman IJ, Cuppen E, Heuven HC, Hazewinkel HA: Genome-wide survey indicates involvement of loci on canine chromosomes 7 and 31 in patellar luxation in Flat-Coated Retrievers. BMC Genet. 2014, 15: 64-PubMedPubMed CentralView ArticleGoogle Scholar

Copyright

© Udagawa et al.; licensee BioMed Central. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement