Skip to main content

The pla gene, encoding plasminogen activator, is not specific to Yersinia pestis


Here we present evidence to show that the pla gene, previously thought to be specific to Yersinia pestis, occurs in some strains of Citrobacter koseri and Escherichia coli. This means that detection of this gene on its own can no longer be taken as evidence of detection of Y. pestis.


Molecular assays aimed at detecting traces of the etiological agent of plague, Yersinia pestis, have focused primarily—and sometimes solely—on the plasminogen activator/coagulase (pla) gene [1, 2]. This gene is located on the pPCP1 plasmid and has been considered the target of choice for plague detection due to its assumed specificity to Y. pestis and its occurrence in multiple copies [35]. However, a recent paper about the amplification of the pla gene from tissues from European rats has raised doubts over whether this gene is indeed specific to Y. pestis [6]. We can now confirm this suspicion.

We screened archaeological samples from Italy (6th, 14th and 17th centuries CE), amplifying a 70-base-pair fragment from the pla gene. Full protocols are described in a previous publication [7], but in brief we performed the work in a dedicated clean laboratory, with physically separated areas for extraction and amplification, following the most stringent criteria for ancient DNA analysis, such as the use of mock extractions and PCR blanks. We used the previously described pla primer pair (Forward primer: GACTGGGTTCGGGCACATGC—Reverse primer: CGGATGTCTTCTCACGGA). Cycling conditions started with an initial activation step at 95 °C for 15 min. This was followed by 50 cycles at 94 °C for 30 s, an assay specific annealing temperature at 60 °C for 30 s, and 72 °C for 1 min, ending with a final elongation step at 72 °C for 10 min. Final cooling was carried out at 8 °C until analysis.

Target-fragment amplifications were observed in 17 out of 40 samples. We sequenced one of the fragments and performed a BLASTN search of the NCBI database, which, as expected, revealed full-length identity (70/70 at nucleotide level) with numerous sequences from Y. pestis. However, we also found full-length identity with two sequences from outside Y. pestis. The first was an annotated contig from a genome assembly of Citrobacter koseri (submitted to GenBank in June 2014, with accession number LK931337). This bacterial species has been recognized as a commensal and pathogen in humans and animals [8, 9]. The second was from a contig from an unannotated genome assembly of Escherichia coli strain FHI29 (submitted to GenBank in June 2014, with accession number LM995843). This sequence is derived from a human fecal isolate from a case of gastroenteritis in Norway. To conduct a more extensive survey, we then performed BLAST searches with the entire pla gene from Y. pestis CO92, which confirmed the high level of similarity (>98 %) with sequences from the genome assemblies of C. koseri (927/939 identities at nucleotide level) and of the E. coli strain FHI29 (925/939 identities) (Fig. 1). The relevant contig from C. koseri contained sequences annotated with plasmid-related functions, suggesting that the pla gene in this context is also plasmid-encoded.

Fig. 1
figure 1

Multiple alignment of pla sequences from Yersinia pestis and two other species

The presence of pla sequences from outside Y. pestis, each derived from a distinct geographical or taxonomic setting, confirms beyond doubt that this gene can no longer be considered specific to Y. pestis. Although there appear to be some potentially informative sequence differences between the pla sequences from Y. pestis and those from other taxa, these findings call into question any results—whether in contemporary diagnostic microbiology or in an ancient DNA setting—that rely on detection of PCR products from this gene alone. Instead, as many researchers in the field already recognise, it is important to obtain sequences from PCR products and detection or identification of Y. pestis should rely on sequences from at least two independent molecular targets. More generally, our observations call into question the wisdom of relying on genes from mobile elements as species-specific markers, given the likelihood that such sequences are able to move from one taxon to another. Interestingly, the roles of the sequence differences between the pla genes, some of which are non-synonymous, in the function and evolution of the pla gene product remain to be determined.


  1. Martin-Alonso A, Soto M, Foronda P, Aguilar E, Bonnet G, Pacheco R, et al. Bartonella spp. and Yersinia pestis reservoirs, Cusco, Peru. Emerg Infect Dis. 2014;20(6):1069–70. doi:10.3201/eid2006.131194.

    PubMed Central  Article  PubMed  Google Scholar 

  2. Loïez C, Herwegh S, Wallet F, Armand S, Guinet F, Courcol RJ. Detection of Yersinia pestis in sputum by real-time PCR. J Clin Microbiol. 2003;41(10):4873–5.

    PubMed Central  Article  PubMed  Google Scholar 

  3. Sodeinde OA, Goguen JD. Genetic analysis of the 9.5-kilobase virulence plasmid of Yersinia pestis. Infect Immun. 1988;56:2743–8.

    PubMed Central  CAS  PubMed  Google Scholar 

  4. Norkina OV, Kulichenko AN, Gintsburg AL, Tuchkov IV, Popov YuA, Aksenov MU, et al. Development of a diagnostic test for Yersinia pestis by the polymerase chain reaction. J Appl Bacteriol. 1994;76:240–5.

    CAS  Article  PubMed  Google Scholar 

  5. Parkhill J, Wren BW, Thomson NR, Titball RW, Holden MT, Prentice MB, et al. Genome sequence of Yersinia pestis, the causative agent of plague. Nature. 2001;413(6855):523–7.

    CAS  Article  PubMed  Google Scholar 

  6. Janse I, Hamidjaja RA, Reusken C. Yersinia pestis plasminogen activator gene homolog in rat tissues. Emerg Infect Dis. 2013;19(2):342–4.

    PubMed Central  Article  PubMed  Google Scholar 

  7. Harbeck M, Seifert L, Hänsch S, Wagner DM, Birdsell D, Parise KL, et al. Yersinia pestis DNA from skeletal remains from the 6th Century AD reveals insights into Justinianic plague. PLoS Pathog. 2013;9(5):e1003349. doi:10.1371/journal.ppat.1003349.

    PubMed Central  CAS  Article  PubMed  Google Scholar 

  8. Komine M, Massa A, Moon L, Mullaney T. Citrobacter koseri Septicaemia in a Holstein Calf. J Comp Pathol. 2014;151(4):309–13. doi:10.1016/j.jcpa.2014.07.005.

    CAS  Article  PubMed  Google Scholar 

  9. Doran TI. The role of Citrobacter in clinical disease of children: review. Clin Infect Dis. 1999;28:384–94.

    CAS  Article  PubMed  Google Scholar 

Download references

Authors’ contributions

EC and GC performed laboratory experiments. SH, GC and MJP performed bioinformatics analyses. RB, GG, NCS and BB conceived of the study, and participated in its design and coordination and helped to draft the manuscript. EC, BB and MJP wrote the manuscript. All authors read and approved the final manuscript.

Compliance with ethical guidelines

Competing interests The authors declare that they have no competing interests.

Author information



Corresponding author

Correspondence to Mark J. Pallen.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Hänsch, S., Cilli, E., Catalano, G. et al. The pla gene, encoding plasminogen activator, is not specific to Yersinia pestis . BMC Res Notes 8, 535 (2015).

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI:


  • Genome Assembly
  • Yersinia Pestis
  • Specific Annealing Temperature
  • Initial Activation Step
  • Fecal Isolate