Skip to main content

Table 1 Characteristics of eight microsatellite loci in the common raven Corvus corax

From: Development and characterization of microsatellite loci for common raven (Corvus corax) and cross species amplification in other Corvidae

Locus Primer sequence (5′–3′) Primer label Repeat motif Ta (°C) n HWE K Ho He GenBank accession no.
Coco6 F: *AACCAAGCTGTCAAAGGAGA VIC (ATCT)13 60/50 20 0.396 8 0.55 0.54 KT288258
R: TTTCCTGGTGCGGAGAAGTA          
Coco12 F: *GAGGCTTTCAGCGATATGGG 6FAM (AGAT)7 60/50 18 0.173 5 0.72 0.72 KT288259
R: GCTGCACTTGCCTGTTGTTTA          
Coco30 F: *GTGCAAACCACTCCAGAAT 6FAM (GGAT)16 60/50 20 0.910 6 0.70 0.80 KT288260
R: GCTGTCACCAGTGGCTTTAAT          
Coco31 F: *TGGCTACTTACCCGGAATCTC NED (ATGT)8 60/50 20 0.470 3 0.25 0.30 KT288261
R: CTTCTCTACCGCCCATCACA          
Coco32 F: ATGCAAATCTCCGTGTATCA NED (ATCT)9 60/50 20 0.422 8 0.80 0.80 KT288262
R: *CCTCCCTTTGTCCTTTCTGG          
Coco36 F: CCTTCTGCGCTGTGTTCAAA NED (CTT)8 60/50 20 0.008 5 0.40 0.71 KT288263
R: *CTGAGGTGCAAGCTTTCCTG          
Coco45 F: TGACCAACACAGAGCAGATATT 6FAM (GT)11 60/50 19 0.353 3 0.53 0.54 KT288264
R: *GGAACCTCTGAGTCCAAA          
Coco50 F: *ATCCCATCAAAGGTCCACG VIC (AC)13 60/50 20 0.157 5 0.50 0.64 KT288265
R: CCACGACAGCTGATGAGAGA          
  1. All loci were in Hardy–Weinberg and linkage equilibrium after Bonferroni correction for multiple tests
  2. Asterisks show location of CAG tag for each primer pair, T a annealing temperatures for touchdown protocol for each locus, n number of individuals genotyped, K number of alleles, H o observed heterozygosity, H e expected heterozygosity