Open Access

Development and characterization of microsatellite loci for common raven (Corvus corax) and cross species amplification in other Corvidae

  • Christin L. Pruett1Email author,
  • Leping Wan1,
  • Tianyu Li1,
  • Cory Spern1,
  • Stacey L. Lance2,
  • Travis Glenn3,
  • Brant Faircloth4 and
  • Kevin Winker5
BMC Research Notes20158:655

https://doi.org/10.1186/s13104-015-1643-5

Received: 17 July 2015

Accepted: 27 October 2015

Published: 6 November 2015

Abstract

Background

A priority for conservation is the identification of endemic populations. We developed microsatellite markers for common raven (Corvus corax), a bird species with a Holarctic distribution, to identify and assess endemic populations in Alaska.

Results

From a total of 50 microsatellite loci, we isolated and characterized 15 loci. Eight of these loci were polymorphic and readily scoreable. Eighteen to 20 common ravens from Fairbanks, Alaska were genotyped showing the following variability: 3–8 alleles per locus, 0.25–0.80 observed heterozygosity (Ho), and 0.30–0.80 expected heterozygosity (He). All loci were in Hardy–Weinberg equilibrium and linkage equilibrium and many loci amplified and were polymorphic in related taxa.

Conclusions

These loci will be used to identify endemic populations of common raven and assess their genetic diversity and connectivity.

Keywords

Corvus PCR primers Microsatellite Holarctic Alaska

Findings

Common raven (Corvus corax) is a widespread, Holarctic bird that is listed as least concern on the IUCN Red List of Threatened Species (http://www.iucnredlist.org/search). Although common ravens in Alaska are not morphologically diverse (2 subspecies) [1], genetic assessments using mitochondrial DNA markers have shown differences among lineages [2] and have suggested that isolated, endemic populations are found in the Aleutian Islands of Alaska [3]. Island populations were possibly isolated in glacial refugia as has been suggested in other studies of Aleutian landbirds [36]. Alternatively, populations might be post-glacial in origin having colonized after the last glacial maximum (~15,000 ybp) [7]. Given the recent timing of these events, a quickly evolving molecular marker is needed to assess the genetic diversity of populations, connectivity among populations, and to understand the history of ravens throughout the Holarctic. We developed eight microsatellite loci that will be used to assess population structure, rates of gene flow, colonization history, and to identify isolated populations of common raven.

Total genomic DNA was extracted from the muscle tissue of two common ravens from Alaska using a QiAamp DNA Mini Kit (Qiagen, Valencia, CA). The protocols of Glenn and Schable [8] and Katzinel et al. [9] were used to isolate microsatellite loci. Briefly, restriction enzymes were used to digest DNA, adapters were ligated onto fragments, microsatellite-containing fragments were separated using biotinylated probes and streptavidin beads, and fragments yields were increased using PCR. Fragments were run on a Roche 454 FLX with Titanium chemistry (454 Life Sciences, a Roche Company, Branford, CT) with similarly treated libraries, each with combinations of unique adapter and Roche MID-tags. We used demuxipy (https://github.com/faircloth-lab/demuxipy/) to demultiplex fragments, and used a version of MSATCOMMANDER [10] to find 591 sequences containing microsatellites from 1467 sequence reads. Primer 3 [11] was used to design primers with the CAG primer sequence (5′-CAGTCGGGCGTCATCA-3′) prepended to the 5′ end of one primer of each pair. This enables the use of a fluorescently labeled primer with the CAG sequence during PCR to tag amplified fragments [12, 13]. A short sequence (GTTT) was prepended to the primer without the CAG sequence to encourage adenylation of the amplicons for accurate genotyping [14, 15].

Fifty primer pairs were tested for amplification and polymorphism using the DNA from 10 individuals. Amplifications were in 20 µl volumes [250 µg/mL BSA, 10× Buffer B (Fisher Scientific), 25 mM MgCl2, 5 µM unlabeled primer, 0.5 µM tag labeled primer, 5 µM universal dye-labeled primer, 2.5 mM dNTPs, 0.5 units Taq DNA polymerase (Fisher Scientific), and 20 ng DNA template] using a BioRad MyCycler thermal cycler. Touchdown cycling conditions were used to amplify DNA and for attachment of the universal dye-labeled primer with the CAG tag. PCR parameters included an initial denaturation step of 2 min 30 s at 95 °C then 20 cycles of 95 °C for 20 s, 65 °C to 50 °C annealing temperature for 20 s (decreasing 0.5 °C per cycle), and extension step of 72 °C for 30 s followed by 15 cycles of 95 °C for 20 s, 55 °C to 45 °C for 20 s, and 72 °C for 30 s. Cycles were followed with a final extension step of 72 °C for 10 min. An ABI3730XL sequencer (Applied Biosystems) was used to determine genotypes. We found that fifteen primers amplified a product and eight of these primers exhibited polymorphism.

Initially, we tested for polymorphism using ten individuals from seven locations in Alaska including locations from the Aleutian Islands, the mainland of Alaska, and islands in southeast Alaska. Herein, we report the statistics associated with polymorphic loci using 18–20 individuals from Fairbanks, Alaska to avoid any Wahlund effect caused by population structure [16]. We also tested the polymorphism of one to three individuals each for seven other species in the family Corvidae (Tables 1, 2) to assess cross-species amplification. We used Gene Mapper software (Applied Biosystems) to score alleles and to determine the number of alleles per locus (K), observed heterozygosity (Ho), and expected heterozygosity (He), using Arlequin ver. 3.5 [17]. We also tested for Hardy–Weinberg equilibrium and linkage disequilibrium using Arlequin and used Microchecker [18] to test for genotyping errors. We found that the number of alleles per locus ranged from 3 to 8, Ho ranged from 0.25 to 0.80, and He ranged from 0.30 to 0.80 for common ravens (Table 1). All loci were in Hardy–Weinberg equilibrium and linkage equilibrium after correction for multiple tests and we found no evidence of null alleles, stuttering, or large-allele dropout.
Table 1

Characteristics of eight microsatellite loci in the common raven Corvus corax

Locus

Primer sequence (5′–3′)

Primer label

Repeat motif

Ta (°C)

n

HWE

K

Ho

He

GenBank accession no.

Coco6

F: *AACCAAGCTGTCAAAGGAGA

VIC

(ATCT)13

60/50

20

0.396

8

0.55

0.54

KT288258

R: TTTCCTGGTGCGGAGAAGTA

         

Coco12

F: *GAGGCTTTCAGCGATATGGG

6FAM

(AGAT)7

60/50

18

0.173

5

0.72

0.72

KT288259

R: GCTGCACTTGCCTGTTGTTTA

         

Coco30

F: *GTGCAAACCACTCCAGAAT

6FAM

(GGAT)16

60/50

20

0.910

6

0.70

0.80

KT288260

R: GCTGTCACCAGTGGCTTTAAT

         

Coco31

F: *TGGCTACTTACCCGGAATCTC

NED

(ATGT)8

60/50

20

0.470

3

0.25

0.30

KT288261

R: CTTCTCTACCGCCCATCACA

         

Coco32

F: ATGCAAATCTCCGTGTATCA

NED

(ATCT)9

60/50

20

0.422

8

0.80

0.80

KT288262

R: *CCTCCCTTTGTCCTTTCTGG

         

Coco36

F: CCTTCTGCGCTGTGTTCAAA

NED

(CTT)8

60/50

20

0.008

5

0.40

0.71

KT288263

R: *CTGAGGTGCAAGCTTTCCTG

         

Coco45

F: TGACCAACACAGAGCAGATATT

6FAM

(GT)11

60/50

19

0.353

3

0.53

0.54

KT288264

R: *GGAACCTCTGAGTCCAAA

         

Coco50

F: *ATCCCATCAAAGGTCCACG

VIC

(AC)13

60/50

20

0.157

5

0.50

0.64

KT288265

R: CCACGACAGCTGATGAGAGA

         

All loci were in Hardy–Weinberg and linkage equilibrium after Bonferroni correction for multiple tests

Asterisks show location of CAG tag for each primer pair, T a annealing temperatures for touchdown protocol for each locus, n number of individuals genotyped, K number of alleles, H o observed heterozygosity, H e expected heterozygosity

Table 2

Number of alleles in eight microsatellite loci in seven Corvidae species

Species

n

Number of alleles per locus

Coco6

Coco12

Coco30

Coco31

Coco32

Coco36

Coco45

Coco50

Fish crow (Corvus ossifragus)

2

4

1

3

1

3

2

2

1

Northwestern crow (Corvus caurinus)

2

3

1

1

3

3

1

American crow (Corvus brachyrhynchos)

1

2

2

1

2

1

1

Steller’s jay (Cyanocitta stelleri)

3

2

1

2

1

3

Blue jay (Cyanocitta cristata)

2

3

2

2

1

2

Gray jay (Perisoreus canadensis)

2

3

1

4

1

1

2

Florida scrub-jay (Aphelocoma coerulescens)

3

n number of individuals attempted to amplify and genotype, – individuals failed to amplify at locus

Preliminary data from nine Alaska populations of common raven showed that the loci developed in this study are useful for population-level assessments with pairwise FST values ranging from 0.011 to 0.51. In addition, these loci are polymorphic in these populations (He 0.40–0.74; alleles per locus, 2.88–6.75). Eight loci that were developed for other Corvidae have shown polymorphism in common raven [19]. By combining our newly developed markers with those from other taxa, it is possible that researchers could assess very fine-scale population structure.

In other Corvidae taxa, we found that the majority of loci amplified and were polymorphic in six of the seven species (Table 2). All loci amplified in the fish crow (Corvus ossifragus) and five of eight loci were polymorphic. Loci that were monomorphic in other taxa might be polymorphic if a larger sample size was assessed. We suggest that these loci could be successfully used for population-level assessments in these species (Table 2) and possibly in other members of the genera Corvus and Perisoreus but are unlikely to be useful in Aphelocoma (Table 2).

Availability of the supporting data

Microsatellite sequences were deposited in the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). They are accessible via GenBank accession numbers listed in Table 1.

Declarations

Authors’ contributions

SL, TG, and BF developed and identified the microsatellite loci. LW, TL, and CS identified polymorphic loci and genotyped samples used in this manuscript. KW performed field work and provided DNA samples of ravens. CLP analyzed the data and wrote the manuscript. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by the Florida Institute of Technology, University of Alaska Museum, and by the U. S. Department of Energy under award number DE-FC09-07SR22506 to the University of Georgia Research Foundation.

Competing interests

The authors declare that they have no competing interests.

Ethics statement

Methods for obtaining samples for this research used the procedures outlined in “Guidelines to the Use of Wild Birds in Research” published by The Ornithological Council (http://www.nmnh.si.edu/BIRDNET/guide/index.html). These guidelines are the appropriate standard for Animal Welfare Act compliance. Bird sampling was approved by the University of Alaska Institutional Animal Care and Use Committee and in compliance with permits from state and federal wildlife agencies.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Biological Sciences, Florida Institute of Technology
(2)
Savannah River Ecology Laboratory, University of Georgia
(3)
Department of Environmental Health Science, University of Georgia
(4)
Department of Biological Sciences, Louisiana State University
(5)
University of Alaska Museum, University of Alaska Fairbanks

References

  1. Gibson DD, Kessel B. Inventory of the species and subspecies of Alaska birds. West Birds. 1997;28:45–95.Google Scholar
  2. Omland KE, Tarr CL, Boarman WI, Marzluff JM, Fleischer RC. Cryptic genetic variation and paraphyly in ravens. Proc Royal Soc Lond B. 2000;267:2475–82.View ArticleGoogle Scholar
  3. Pruett CL, Winker K. Evidence for cryptic northern refugia among high- and temperate-latitude species in Beringia—a response to Stewart and Dalen (2008). Clim Change. 2008;38:23–7.View ArticleGoogle Scholar
  4. Holder K, Montgomerie R, Friesen VL. Glacial vicariance and historical biogeography of rock ptarmigan (Lagopus mutus) in the Bering region. Mol Ecol. 2000;9:1265–78.View ArticlePubMedGoogle Scholar
  5. Pruett CL, Winker K. Biological impacts of climatic change on a Beringian endemic: cryptic refugia in the establishment and differentiation of the rock sandpiper (Calidris ptilocnemis). Clim Change. 2005;68:219–40.View ArticleGoogle Scholar
  6. Pruett CL, Turner TN, Topp CM, Zagrebelny S, Winker K. Divergence in an archipelago and its conservation consequences in rock ptarmigan. Conserv Genetics. 2010;11:241–8.View ArticleGoogle Scholar
  7. Pruett CL, Winker K. Northwestern song sparrow populations show genetic effects of sequential colonization. Mol Ecol. 2005;14:1421–34.View ArticlePubMedGoogle Scholar
  8. Glenn TC, Schable NA. Isolating microsatellite DNA loci. Methods Enzymol. 2005;395:202–22.View ArticlePubMedGoogle Scholar
  9. Kartzinel TR, Trapnell DW, Glenn TC. Microsatellite primers for the Neotropical epiphyte Epidendrum firmum (Orchidaceae). Am J Bot. 2012;99:e450–2.View ArticlePubMedGoogle Scholar
  10. Faircloth BC. MSATCOMMANDER: detection of microsatellite repeat arrays and automated, locus-specific primer design. Mol Ecol Resour. 2008;8:92–4.View ArticlePubMedGoogle Scholar
  11. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm N, Rozen SG. Primer3—new capabilities and interfaces. Nucl Acids Res. 2012;40:e115.PubMed CentralView ArticlePubMedGoogle Scholar
  12. Schuelke M. An economic method for the fluorescent labeling of PCR fragments. Nat Biotech. 2000;18:233–4.View ArticleGoogle Scholar
  13. Hauswaldt JS, Glenn TC. Microsatellite DNA loci for the diamondback terrapin (Malaclemys terrapin). Mol Ecol Resour. 2003;3:174–6.Google Scholar
  14. Brownstein MJ, Carpten JD, Smith JR. Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. Biotechniques. 1996;20:1004–10.PubMedGoogle Scholar
  15. Traxler B, Brem G, Muller M, Achmann R. Polymorphic DNA microsatellites in the domestic pigeon, Columba livia var. domestica. Mol Ecol. 2000;9:366–8.View ArticlePubMedGoogle Scholar
  16. Hartl DL, Clark AG. Principles of population genetics. 4th ed. Sunderland: Sinauer Associates; 1997.Google Scholar
  17. Excoffier L, Laval G, Schneider S. Arlequin ver. 3.0: an integrated software package for population genetics data analysis. Evol Bioinforma Online. 2005;1:47–50.Google Scholar
  18. Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes. 2004;4:535–8.View ArticleGoogle Scholar
  19. Fleischer RC, Boarman WI, Gonzalez EG, Godinez A, Omland KE, Young S, Helgen L, Syed G, McIntosh CE. As the raven flies: using genetic data to infer the history of invasive common raven (Corvus corax) populations in the Mojave Desert. Mol Ecol. 2008;17:464–74.View ArticlePubMedGoogle Scholar

Copyright

© Pruett et al. 2015

Advertisement