Skip to main content

Advertisement

Table 2 A collection of forty three successfully amplified primers

From: Variation in sequences containing microsatellite motifs in the perennial biomass and forage grass, Phalaris arundinacea (Poaceae)

Primer name Isotiq position Repeat motif Primer sequence (5′-3′) Ta
TeaPh_nSSR_1 00060-1 (AC)4 F: TACTTCATTGGGTGGGATGG R: CGCGAATGAAATGAGAAAGC 54
TeaPh_nSSR_2 00060-2 (AT)4 F: GGTGGCTAATCTCAGGAATGG R: TGCCCGATAATAAGCACTAGC 54
TeaPh_nSSR_3 08186-1 (TTG)4 F: GGTAAATTCAGATTATTCCAAAACC R: CCTTTTTGAATGGCAGTTCC 53
TeaPh_nSSR_4 01314-2 (TGT)4 F: AACGGTGACAAAAGACAAAGC R: CAGCCGTATATCCACAATGC 54
TeaPh_nSSR_5 01313-2 (TGT)4 F: AACGGTGACAAAAGACAAAGC R: CAGCCGTATATCCACAATGC 54
TeaPh_nSSR_6 08185-3 (ATT)4 F: TGGCCAACTCTCAGTAGAAGG R: CCATGACCAAAATGAACTCC 53
TeaPh_nSSR_7 00075-2 (TTCT)4 F: TCCCCTCTTTGTTTATCATTCG R: GAATCCGGTAAGGTACTTTTGG 54
TeaPh_nSSR_8 00074-2 (TTCT)4 F: TCCCCTCTTTGTTTATCATTCG R: GAATCCGGTAAGGTACTTTTGG 54
TeaPh_nSSR_9 00068-2 (TTCT)4 F: TCCCCTCTTTGTTTATCATTCG R: GAATCCGGTAAGGTACTTTTGG 54
TeaPh_nSSR_10 03441-1 (TA)4 F: TGCAATGATTTTCTCTATCTTGC R: TCTATCGCTTCACTTTGTCTCG 53
TeaPh_nSSR_11 03440-1 (TA)4 F: TGCAATGATTTTCTCTATCTTGC R: TCTATCGCTTCACTTTGTCTCG 53
TeaPh_nSSR_13 00265-3 (GA)4 F: AGCAAGTATGCCGAAAGACC R: GGGAGACCCACACTTACAGC 54
TeaPh_nSSR_16 03439-1 (CT)4 F: GTACCCGAAACCGACACAGG R: CCCCCATACATGGTCTTACG 55
TeaPh_nSSR_17 03438-1 (CT)4 F: TTCTCCACGAGGCTCATACC R: GAAGTTACGGGGCTATTTTGC 55
TeaPh_nSSR_19 03440-4 (AT)4 F: TTCCGAATTAAATGGAGAATCC R: GATAACGGGACATGAAGACTCC 54
TeaPh_nSSR_20 00072-1 (AT)4 F: GGTGGCTAATCTCAGGAATGG R: TGCCCGATAATAAGCACTAGC 54
TeaPh_nSSR_21 08188-1 (AG)4 F: CAATGCCAAAGAAACAATGC R: ACCTCAGATCGAAGCATTCC 54
TeaPh_nSSR_23 00071-1 (AC)4 F: TACTTCATTGGGTGGGATGG R: CGCGAATGAAATGAGAAAGC 56
TeaPh_nSSR_24 03440-3 (AT)5 F: GAATGAAAATGCCAATAAAGTCG R: TTTTATTTCTCTAATTCGCAAATCC 54
TeaPh_nSSR_25 08351-5 (TGC)10 F: TCCTATGATCTCTGCCTCAGC R: GCACTGTCCATCAACACACC 55
TeaPh_nSSR_34 01672-8 (CCGAAACA)3 F: TTACCGACTCCGTCTTGACC R: GTCGATGGAGATGACGTTGG 55
TeaPh_nSSR_37 03471-10 (TTTTGAA)3 F: GTGTTTGGCCTGTAATCTGG R: CGTAAATGCATCTCTATCTGTTCC 53
TeaPh_nSSR_42 01705-4 (GT)8 F: TCAAGTGTCATCCGTTGTCC R: TTTTAACGCAAATAGTTTCATCG 53
TeaPh_nSSR_43 02516-1 (GT)6 F: TGGACTGCACCTAGGAGACC R: TACCACCATGGAACAAAACG 54
TeaPh_nSSR_45 08327-5 (GC)4 F: AAAGTACATTGAAAGCTAGTGTCACC R: GCCTCCAAAGCAAGATGC 54
TeaPh_nSSR_46 03588-3 (CG)6 F: TCTCCGCTCGATCTAAATAGC R: TGTGTGTGCTGAAAGTGTCG 55
TeaPh_nSSR_47 01700-4 (CG)4 F: GACAGATGGGGCACTACTCC R: GTGTGAGGAATCCACAGTGC 54
TeaPh_nSSR_48 02594-3 (TAA)6 F: AAGAGTGTCACCATGGAGTGG R: ACCTTCTGAGAGCCTCTTGC 54
TeaPh_nSSR_49 02597-9 (GCA)5 F: GATACGCTGGAATACCAGAAGG R: GGGAATGGAAACGAACAGG 55
TeaPh_nSSR_50 08302-4 (GAA)5 F: AAGAGGAAGCCGAAGAGTGG R: TCTGTGGTGCTCAGTTCAGG 55
TeaPh_nSSR_52 08189-10 (GAT)3 F: TTAACTCGAGGTCATGCATCC R: CCTTTAGCGTCCAAAACTGC 55
TeaPh_nSSR_54 08427-4 (CAA)4 F: ACATCCACAGGATTCCATGC R: GCCAGAGATGAGAAGGATGC 55
TeaPh_nSSR_55 02553-8 (CAT)3 F: AGCAACCAGAACCTGACACG R: AGATGGTACGGCTGGTATGC 55
TeaPh_nSSR_57 02609-7 (CGG)4 F: GTTCGCTTCGATTTGTTTCC R: CGAAATGAACGGCCTAATCC 55
TeaPh_nSSR_58 08459-13 (GCTC)4 F: TCCCGACTTCATGAGCTACC R: GGAGGAGCATGTGTGAATGG 55
TeaPh_nSSR_59 00075-2 (TTCT)4 F: TCCCCTCTTTGTTTATCATTCG R: GAATCCGGTAAGGTACTTTTGG 54
TeaPh_nSSR_60 01318-11 (AGGA)3 F: GGGCTTTCTACATAGGGATCG R: TTGATCTTTACGGTGCTTTCC 54
TeaPh_nSSR_65 08352-6 (AGG)4 F: CTCCACCACCTCCACAAAAT R: TTTCGTCTTTGTGCTTGCTG 55
TeaPh_nSSR_66 00769-7 (TTG)3 F: CGTTGTGCCTTAGCTACTTGC R: ATGATCCAACCAGCTTGACC 55
TeaPh_nSSR_70 08235-11 (TGCT)3 F: CCTTGAGGAGGATGATGTGG R: TCCTGATGTGCTTGATGAGC 55
TeaPh_nSSR_71 08212-11 (TTCA)3 F: GATGGAATCACGCTCTGTAGG R: GGGCAGTAGCGAAGAGATCC 55
TeaPh_nSSR_80 03674-1 (GAT)4 F: CCAAACCCAGTTGTGACTCC R: GGCATCAGAATCATAGTCATCG 55
TeaPh_nSSR_81 03659-2 (GGT)5 F: CGGTTGGACTGATAACATTGG R: CCCATCCTGAGTCGTCACC 55
  1. Forty three primers that successfully amplified a distinct band of expected size on a 3 % MetaPhor agarose gel, their Isotiq position on the EST assembly, repeat motif, forward and reverse primer sequences (5′-3′) and annealing temperature (Ta)