Open Access

Variation in sequences containing microsatellite motifs in the perennial biomass and forage grass, Phalaris arundinacea (Poaceae)

BMC Research Notes20169:184

https://doi.org/10.1186/s13104-016-1994-6

Received: 1 February 2016

Accepted: 16 March 2016

Published: 22 March 2016

Abstract

Forty three microsatellite markers were developed for further genetic characterisation of a forage and biomass grass crop, for which genomic resources are currently scarce. The microsatellite markers were developed from a normalized EST-SSR library. All of the 43 markers gave a clear banding pattern on 3 % Metaphor agarose gels. Eight selected SSR markers were tested in detail for polymorphism across eleven DNA samples of large geographic distribution across Europe. The new set of 43 SSR markers will help future research to characterise the genetic structure and diversity of Phalaris arundinacea, with a potential to further understand its invasive character in North American wetlands, as well as aid in breeding work for desired biomass and forage traits. P. arundinacea is particularly valued in the northern latitude as a crop with high biomass potential, even more so on marginal lands.

Keywords

Poaceae Microsatellite markers Phalaris arundinacea Reed canary grass SSR

Introduction

Slight changes in the genetic code, such as single nucleotide polymorphisms (SNPs) and single sequence repeats (SSRs) can be directly linked to phenotype differences. Hence, the development and characterisation of novel genetic markers can be of great help to breeders. SSRs have been commonly applied in quantifying genetic variation and analysing the gene flow and parentage in plants [1]. Some recent applications also include hybrid identification [2]. Single sequence repeats are abundant in the genome, multi-allelic and polymorphic and often can be cross-amplified on related species [3]. Next-generation sequencing can provide large numbers of SSRs as demonstrated in this study and is even more useful once converted into routinely applicable genetic markers.

The genus Phalaris belongs to the tribe Aveneae of the subfamily Pooideae of the grass and cereal family Poaceae [4]. Reed canarygrass (Phalaris arundinacea L.) is a tall, perennial C3 grass which is distributed throughout Europe and in temperate regions of North America and Asia [5, 6]. On many sites it forms dense monospecific stands [7]. Considered an invasive wetland species [8, 9], P. arundinacea has been successfully introduced into nearly all continents except Antarctica. It is most commonly found growing along water margins and as such has been long recognised as a crop with a high biomass potential, particularly on marginal lands. Reed canarygrass, although not as productive as other grasses (i.e., Panicum virgatum) presents a unique set of characters that make it particularly tolerant to Northern climates [10]. Its high genetic variability has been observed in differences in production rates [8], forage yields [11] and photosynthetic characteristics [12] among others. Other non-crop uses of reed canarygrass include phytoremediation [13], erosion control [14] and paper production [15]. The newly developed primers presented in this publication were tested across a wide range of environmentally and climatically different regions from six European countries of Northern European distribution (Table 1). A subsample of three reactions per primer with one exception (primer TeaPh_nSSR_25) were chosen for sequencing (Fig. 1). These microsatellites can potentially be used for fingerprinting, GenBank accession characterisation and cross-amplification with other important and closely related forage grass species like P. aquatica [16]. Furthermore, microsatellite markers are routinely used to infer invasion routes of invading species [17], and as such could aid in understanding its invasive success in Northern America. Publically available genomic resources for the genus Phalaris are generally scarce; hence the primers are of high value for future research.
Table 1

Eleven genotypes characterized in this study

Country

Sample name

Latitude

Longitude

Poland

A

53° 50′02.83″N

21° 03′30.36″E

Poland

H

54° 23′21.42″N

18° 28′42.18″E

Germany

B

52° 13′09.87″N

11° 42′25.14″E

Germany

D

53° 25′51.60″N

09° 46′39.78″E

Denmark

I

56° 12′13.48″N

08° 09′39.07″E

Denmark

E

55° 56′16.98″N

12° 28′35.70″E

Sweden

F

58° 52′20.04″N

14° 53′56.79″E

Sweden

K

64° 36′27.31″N

20° 57′04.32″E

Ireland

G

53° 35′24.27″N

08° 03′33.69″W

UK

C

52° 29′17.12″N

00° 55′59.12″W

UK

J

52° 44′34.76″N

01° 08′09.87″W

The eleven genotypes are grouped by six European countries (sample names corresponding to Fig. 1) with latitude and longitude coordinates of their origin

Fig. 1

Representative image of amplified product for ten different EST-SSR markers. The samples were run on 3 % MetaPhor™ gel and three or, in one case seven different genotypes from wide geographic locations were amplified. The gel was post-stained with 3x gelRED for 1 h. Lane M—100 bp DNA ladder (New England BioLabs, Herts, United Kingdom); sample order and geographic distribution are defined in Table 1

Methods

Total genomic DNA was extracted from eleven genotypes which were collected as part of the European Grass Margins project (Table 1) by either fresh extraction in liquid nitrogen or freeze-drying prior to extraction following a standard cetyltrimethylammonium bromide (CTAB) method [18]. Initially ninety primer pairs were designed using the Primer3 online programme (http://biotools.umassmed.edu/bioapps/primer3_www.cgi) from a normalized EST library consisting of 18,682 P. arundinacea transcripts [19] (sequence data available at the Sequence Read Archive at NCBI, accession number SRP045256) upon searching for microsatellites with Gramene SSRIT (Simple Sequence Repeat Identification Tool; http://archive.gramene.org/db/markers/ssrtool). The following core criteria were applied for primer design: (1) primer melting temperature between 57 and 63 ℃ with 60 ℃ as optimum; (2) primer size (bp) ranging from 18 to 27 ℃ with 20 ℃ as optimum; (3) product size (bp) ranging from 100 to a maximum of 400 with 200 as optimum; and (4) CG clump of two. We found microsatellites varying in repeat motifs from di- up to nona-, the majority of which were dinucleotide repeats. The primers used in this study were selected from a range of SSR repeat motifs (Table 2). All primers were synthesised by Metabion international AG and were subsequently tested by PCR on standard agarose gels first. Out of 90 initially tested SSR markers 43 were retained since they produced clear banding pattern in the expected size range on a 3 % MetaPhor™ agarose gel in 1 × TAE buffer. The further selection process of eight SSR markers which were characterized in detail was based on the indication that they might be highly polymorphic. The PCR products were run on a pre-stained gel with Ethidium bromide and placed at 4 ℃ for around 20 min to aid in obtaining optimal resolution and gel handling characteristics, as per manufacturer’s specifications. Primer details and GenBank accessions are provided in Table 3. A template DNA volume of 1 µL (40 ng/µL) was amplified with initial denaturation step for 5 min at 95 ℃ followed by 35 cycles each with a denaturation of 30 s at 95 ℃, 20 s at a primer specific annealing temperature, and extension of 20 s at 72 ℃, followed by a final extension at 72 ℃ for 7 min. The reaction mixture contained 1 × reaction buffer consisting of 1.25 µM dNTPs, 10 µM of each primer, and 0.5 U of Taq DNA polymerase (New England BioLabs, Herts, United Kingdom). The primers were tested for polymorphism originating from six European countries, in a total of eleven samples each from a different geographic region (Table 1). Purified PCR products (QIAquick PCR purification kit, Germantown, USA) were then sequenced by Sanger sequencing from both ends by GATC Biotech Ltd., London, England.
Table 2

A collection of forty three successfully amplified primers

Primer name

Isotiq position

Repeat motif

Primer sequence (5′-3′)

Ta

TeaPh_nSSR_1

00060-1

(AC)4

F: TACTTCATTGGGTGGGATGG R: CGCGAATGAAATGAGAAAGC

54

TeaPh_nSSR_2

00060-2

(AT)4

F: GGTGGCTAATCTCAGGAATGG R: TGCCCGATAATAAGCACTAGC

54

TeaPh_nSSR_3

08186-1

(TTG)4

F: GGTAAATTCAGATTATTCCAAAACC R: CCTTTTTGAATGGCAGTTCC

53

TeaPh_nSSR_4

01314-2

(TGT)4

F: AACGGTGACAAAAGACAAAGC R: CAGCCGTATATCCACAATGC

54

TeaPh_nSSR_5

01313-2

(TGT)4

F: AACGGTGACAAAAGACAAAGC R: CAGCCGTATATCCACAATGC

54

TeaPh_nSSR_6

08185-3

(ATT)4

F: TGGCCAACTCTCAGTAGAAGG R: CCATGACCAAAATGAACTCC

53

TeaPh_nSSR_7

00075-2

(TTCT)4

F: TCCCCTCTTTGTTTATCATTCG R: GAATCCGGTAAGGTACTTTTGG

54

TeaPh_nSSR_8

00074-2

(TTCT)4

F: TCCCCTCTTTGTTTATCATTCG R: GAATCCGGTAAGGTACTTTTGG

54

TeaPh_nSSR_9

00068-2

(TTCT)4

F: TCCCCTCTTTGTTTATCATTCG R: GAATCCGGTAAGGTACTTTTGG

54

TeaPh_nSSR_10

03441-1

(TA)4

F: TGCAATGATTTTCTCTATCTTGC R: TCTATCGCTTCACTTTGTCTCG

53

TeaPh_nSSR_11

03440-1

(TA)4

F: TGCAATGATTTTCTCTATCTTGC R: TCTATCGCTTCACTTTGTCTCG

53

TeaPh_nSSR_13

00265-3

(GA)4

F: AGCAAGTATGCCGAAAGACC R: GGGAGACCCACACTTACAGC

54

TeaPh_nSSR_16

03439-1

(CT)4

F: GTACCCGAAACCGACACAGG R: CCCCCATACATGGTCTTACG

55

TeaPh_nSSR_17

03438-1

(CT)4

F: TTCTCCACGAGGCTCATACC R: GAAGTTACGGGGCTATTTTGC

55

TeaPh_nSSR_19

03440-4

(AT)4

F: TTCCGAATTAAATGGAGAATCC R: GATAACGGGACATGAAGACTCC

54

TeaPh_nSSR_20

00072-1

(AT)4

F: GGTGGCTAATCTCAGGAATGG R: TGCCCGATAATAAGCACTAGC

54

TeaPh_nSSR_21

08188-1

(AG)4

F: CAATGCCAAAGAAACAATGC R: ACCTCAGATCGAAGCATTCC

54

TeaPh_nSSR_23

00071-1

(AC)4

F: TACTTCATTGGGTGGGATGG R: CGCGAATGAAATGAGAAAGC

56

TeaPh_nSSR_24

03440-3

(AT)5

F: GAATGAAAATGCCAATAAAGTCG R: TTTTATTTCTCTAATTCGCAAATCC

54

TeaPh_nSSR_25

08351-5

(TGC)10

F: TCCTATGATCTCTGCCTCAGC R: GCACTGTCCATCAACACACC

55

TeaPh_nSSR_34

01672-8

(CCGAAACA)3

F: TTACCGACTCCGTCTTGACC R: GTCGATGGAGATGACGTTGG

55

TeaPh_nSSR_37

03471-10

(TTTTGAA)3

F: GTGTTTGGCCTGTAATCTGG R: CGTAAATGCATCTCTATCTGTTCC

53

TeaPh_nSSR_42

01705-4

(GT)8

F: TCAAGTGTCATCCGTTGTCC R: TTTTAACGCAAATAGTTTCATCG

53

TeaPh_nSSR_43

02516-1

(GT)6

F: TGGACTGCACCTAGGAGACC R: TACCACCATGGAACAAAACG

54

TeaPh_nSSR_45

08327-5

(GC)4

F: AAAGTACATTGAAAGCTAGTGTCACC R: GCCTCCAAAGCAAGATGC

54

TeaPh_nSSR_46

03588-3

(CG)6

F: TCTCCGCTCGATCTAAATAGC R: TGTGTGTGCTGAAAGTGTCG

55

TeaPh_nSSR_47

01700-4

(CG)4

F: GACAGATGGGGCACTACTCC R: GTGTGAGGAATCCACAGTGC

54

TeaPh_nSSR_48

02594-3

(TAA)6

F: AAGAGTGTCACCATGGAGTGG R: ACCTTCTGAGAGCCTCTTGC

54

TeaPh_nSSR_49

02597-9

(GCA)5

F: GATACGCTGGAATACCAGAAGG R: GGGAATGGAAACGAACAGG

55

TeaPh_nSSR_50

08302-4

(GAA)5

F: AAGAGGAAGCCGAAGAGTGG R: TCTGTGGTGCTCAGTTCAGG

55

TeaPh_nSSR_52

08189-10

(GAT)3

F: TTAACTCGAGGTCATGCATCC R: CCTTTAGCGTCCAAAACTGC

55

TeaPh_nSSR_54

08427-4

(CAA)4

F: ACATCCACAGGATTCCATGC R: GCCAGAGATGAGAAGGATGC

55

TeaPh_nSSR_55

02553-8

(CAT)3

F: AGCAACCAGAACCTGACACG R: AGATGGTACGGCTGGTATGC

55

TeaPh_nSSR_57

02609-7

(CGG)4

F: GTTCGCTTCGATTTGTTTCC R: CGAAATGAACGGCCTAATCC

55

TeaPh_nSSR_58

08459-13

(GCTC)4

F: TCCCGACTTCATGAGCTACC R: GGAGGAGCATGTGTGAATGG

55

TeaPh_nSSR_59

00075-2

(TTCT)4

F: TCCCCTCTTTGTTTATCATTCG R: GAATCCGGTAAGGTACTTTTGG

54

TeaPh_nSSR_60

01318-11

(AGGA)3

F: GGGCTTTCTACATAGGGATCG R: TTGATCTTTACGGTGCTTTCC

54

TeaPh_nSSR_65

08352-6

(AGG)4

F: CTCCACCACCTCCACAAAAT R: TTTCGTCTTTGTGCTTGCTG

55

TeaPh_nSSR_66

00769-7

(TTG)3

F: CGTTGTGCCTTAGCTACTTGC R: ATGATCCAACCAGCTTGACC

55

TeaPh_nSSR_70

08235-11

(TGCT)3

F: CCTTGAGGAGGATGATGTGG R: TCCTGATGTGCTTGATGAGC

55

TeaPh_nSSR_71

08212-11

(TTCA)3

F: GATGGAATCACGCTCTGTAGG R: GGGCAGTAGCGAAGAGATCC

55

TeaPh_nSSR_80

03674-1

(GAT)4

F: CCAAACCCAGTTGTGACTCC R: GGCATCAGAATCATAGTCATCG

55

TeaPh_nSSR_81

03659-2

(GGT)5

F: CGGTTGGACTGATAACATTGG R: CCCATCCTGAGTCGTCACC

55

Forty three primers that successfully amplified a distinct band of expected size on a 3 % MetaPhor agarose gel, their Isotiq position on the EST assembly, repeat motif, forward and reverse primer sequences (5′-3′) and annealing temperature (Ta)

Table 3

Eight highly polymorphic nuclear EST-SSR markers with GenBank accession numbers and size range

Primer name

Clone; GenBank accession no.

Size range (bp)

TeaPh_nSSR_2

KU316389; KU316392; KU316395

191

TeaPh_nSSR_4

KU316399; KU316400; KU316403; KU316416; KU316414

240–241

TeaPh_nSSR_7

KU316423; KU316427; KU316426; KU316429; KU316433

247

TeaPh_nSSR_24

KU316439; KU316441; KU316443; KU316444

197

TeaPh_nSSR_46

KU316451; KU316452; KU316458; KU316467; KU316471

178–186

TeaPh_nSSR_47

KU316485; KU316486; KU316489; KU316476

261–269

TeaPh_nSSR_49

KU316491; KU316492; KU316495; KU316498

152–166

TeaPh_nSSR_80

KU316500; KU316501; KU316506; KU316512

144–150

The study developed eight polymorphic EST-SSR markers containing polymorphism such as SSRs, InDels and SNPs

Results and discussion

43 out of the 90 initially designed microsatellite marker primer pairs proved to amplify successfully with discreet bands. Eight highly polymorphic SSR loci for P. arundinacea were identified which ranged in size from around 300 to 200 bp in length (Table 3). Sanger sequencing revealed numerous single nucleotide polymorphisms (SNPs), motif changes as well as indels in the genotypes of Phalaris from the different geographical locations (Fig. 2). Changes in the motif length varied from tetra- to tri-, di- and even mononucleotide repeats. In some instances the repeat motif was longer than expected (from tetra- to hepta- and nonanucleotide repeats). Changes were also observed from penta- to tetra- and hexanucleotide repeats. These microsatellite markers are useful for studying genetic diversity and population structure as well as for elucidation of P. arundinacea invasive status. As an increasingly important energy crop and well established forage crop species, the improvement of bioenergy and palatability traits for livestock, P. arundinacea might be of interest to breeders worldwide. The markers can be also further cross-amplified in closely related taxa like P. aquatica, an important forage species in Australasia, and other members of the genus Phalaris like P. minor a widely spread grass weed. These eight microsatellite markers will be of interest and value in addressing taxonomic and biogeographic issues because of the samples’ wide geographic distribution.
Fig. 2

Example of motif changes, indels and SNPs in the microsatellite region of nine representative samples. a fragments amplified with primer TeaPh_nSSR49; 1 Poland (accession number KU316491); 2 Ireland (accession number KU316495); 3 Ireland (accession number KU316498). b fragments amplified with primer TeaPh_nSSR80; 4 Poland (accession number KU316501); 5 Poland (KU316502); 6 Poland (KU316514). c fragments amplified with primer TeaPh_nSSR46; 7 Germany (accession number KU316457); 8 Denmark (KU316467); 9 United Kingdom (KU316471)

Declarations

Authors’ contributions

SB, MK, TS, TV and TRH conceived the study. SB, MJ, MK, TV and TRH wrote the manuscript. SB, MK, MJ and TV conducted the experiments. All authors read and approved the final manuscript.

Acknowledgements

We are grateful to Yasmin Soppa and Niall McLoughlin for technical help in the lab.

Competing interests

The authors declare that they have any competing interests.

Funding

This study has been financed under the collaborative European Community Framework FP7 project GrassMargins (KBBE-2011-5-289461).

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Teagasc Crops Environment and Land Use Programme, Oak Park Research Centre
(2)
Department of Botany, School of Natural Sciences, Trinity College Dublin

References

  1. Smulders MJM, Esselink GD, Everaert I, De Riek J, Vosman B. Characterisation of sugar beet (Beta vulgaris L. ssp. vulgaris) varieties using microsatellite markers. BMC Genet. 2010;11:41.View ArticlePubMedPubMed CentralGoogle Scholar
  2. Turchetto C, Segatto ALA, Beduschi J, Bonatoo SL, Freitas LB. Genetic differentiation and hybrid identification using microsatellite markers in closely related wild species. AoB Plants. 2015;7:1–12.View ArticleGoogle Scholar
  3. Chase M, Kesseli R, Bawa K. Microsatellite markers for conservation and population genetics of tropical tree species. AJB. 1996;83:51–7.View ArticleGoogle Scholar
  4. Forster JW, Hand ML, Cogan NOI, Hayes BJ, German C, Smith KF. Resources and strategies for implementation of genomic selection in breeding of forage species. Crop and Pasture. Science. 2014;65:1238–47.Google Scholar
  5. Sheaffer CC, Marten GC. Reed canarygrass: An introduction to grassland agriculture. In: Barnes RF, Miller RF, Darrell A, Nelson CJ, editors. Forages. Iowa: IOWA State University Press; 1995. p. 335–43.Google Scholar
  6. Ghica A, Samfira I. Bibliographic study of genetic process in Phalaris arundinacea. Res J Agric Sci. 2011;43:65–71.Google Scholar
  7. Apfelbaum SI, Sams CE. Ecology and control of reed canary grass (Phalaris arundinacea L.). Nat Areas J. 1987;7:69–74.Google Scholar
  8. Lavergne S, Molofsky J. Increased genetic variation and evolutionary potential drive the success of an invasive grass. Proc Natl Acad Sci. 2007;104:3883–8.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Martina JP, Von Ende CN. Increased spatial dominance in high nitrogen, saturated soil due to clonal architecture plasticity of the invasive wetland plant, Phalaris arundinacea. Plant Ecol. 2013;214:1443–53.View ArticleGoogle Scholar
  10. Ramstein GP, Lipka AE, Lu F, Costich DE, Cherney JH, Buckler ES, Casler MD. Genome-wide association study based on multiple imputation with low-depth sequencing data: application to biofuel traits in reed canarygrass. G3: Genes |Genomes |Genetics. 2015. http://www.g3journal.org/content/early/2015/03/12/g3.115.017533.full.pdf+html. Accessed 13 July 2015.
  11. Rydberg PA. Phyotogeographical notes on the Rocky Mountain region. V. Grasslands of the subalpine and montane zones. Bull Torrey Bot Club. 1915;42:629–42.View ArticleGoogle Scholar
  12. Brodersen C, Lavergne S, Molofsky J. Genetic variation in photosynthetic characteristics among invasive and native populations of reed canarygrass (Phalaris arundinacea). Biol Invasions. 2008;10:1317–25.View ArticleGoogle Scholar
  13. Picard CR, Fraser LH, Steer D. The interacting effects of temperature and plant community type on nutrient removal in wetland microcosms. Bioresour Technol. 2005;96:1039–47.View ArticlePubMedGoogle Scholar
  14. Rice J, Pinkerton B. Reed canarygrass survival under cyclic inundiation. J Soil Water Conserv. 1993;48:132–5.Google Scholar
  15. Pakhala K, Pihala M. Different plant parts as raw material for fuel and pulp production. Ind Crops Prod. 2000;11:119–28.View ArticleGoogle Scholar
  16. Carlson IT, Oram RN, Suprenant J. Reed canarygrass and other Phalaris species. Agron Monogr. 1996;34:569–604.Google Scholar
  17. Estoup A, Guillemaud T. Reconstructing routes of invasion using genetic data: Why, how and so what? Mol Ecol. 2010;19:4113–30.View ArticlePubMedGoogle Scholar
  18. Doyle JJ, Doyle JL. Isolation of plant DNA from fresh tissue. Focus. 1990;12:13–5.Google Scholar
  19. Haiminen N, Klaas M, Zhou Z, Utro F, Cormican P, Didion T, Jensen CS, Mason C, Barth S, Parida L. Comparative exomics of Phalaris cultivars under salt stress. BMC Genom. 2014;15(Suppl 6):S18.View ArticleGoogle Scholar

Copyright

© Barth et al. 2016

Advertisement