Methods
The following oligonucleotides were synthesized and gel purified (Sigma-Genosis): 5′CTCGAGATAACTTCGTATAAAGTATCCTATACGAAGTTATCCC3′ and 5′ATAAACTTCGTATAGGATACTTTATACGAAGTTATCTCGAGGGG3′. Each oligonucleotide was dissolved in 10 mM Tris–Cl, 1 mM EDTA, pH 8.0 (TE) at a final concentration of 1 μg/ml and incubated at 4 °C overnight. The oligonucleotides were combined in the presence of 50 mM NaCl and heated to 80 °C for 5 min and then slowly cooled to room temperature.
A 500-fold molar excess of the double-stranded oligonucleotide was incubated with pBeloBac11 DNA that had been digested with SfiI for 2 h at 37 °C (New England BioLabs) in the presence of 1 U of T4 DNA ligase (Invitrogen) at 15 °C overnight. The ligation reaction was heat inactivated at 70 °C for 15 min and then spot dialyzed against 0.5X TE for 1 h. Two μl aliquots of the ligation reaction were mixed with 25 μl of electrocompetent DH10B cells (Invitrogen), placed into a 1 cm gap cuvette (BTX) and electroporated at 2.5 kV and 129 Ohms using the BTX Electro Cell Manipulator 600. The cells were allowed to recover in 1 ml SOC media (Invitrogen) at 37 °C and 225 rpm for 1 h and then 100 μl aliquots were spread onto LB + 34 μg/ml CM (Sigma) plates. Individual colonies were grown overnight in 2.5 ml of LB + CM media and DNA was generated using an alkaline lysis miniprep procedure [8]. The DNA samples were digested with 10 U of XhoI for 2 h at 37 °C (New England BioLabs) and electrophoresed in a 0.8% agarose gel in 0.5X TBE.
Results
Since the BAC cloning vector pBeloBAc11 was commercially available from New England BioLabs, I decided to modify this plasmid to increase its utility for genomics studies. Two complementary oligonucleotides containing the 2272 version of the mutant loxP site were designed and synthesized. I also incorporated a XhoI restriction site at the 5′ end of the CTCGAGATAACTTCGTATAAAGTATCCTATACGAAGTTATCCC oligonucleotide and the 3′ end of the complimentary oligonucleotide to allow for identification of successful insertion of the mutant loxP site into pBeloBac11, which contains a single XhoI site (Fig. 1). Then the oligonucleotides were combined and heated to 80 °C and allowed to slowly cool to room temperature so that annealing would occur.
A 500-fold molar excess of the double stranded oligonucleotide was ligated to SfiI-digested pBeloBac11 and the ligations were electroporated into DH10B cells and spread onto LB + chloramphenicol (CM) plates. I obtained miniprep DNA from several transformants, digested them with XhoI and analyzed the clones by agarose gel electrophoresis. The desired clone would generate two bands of 5.8 and 1.7 kb, while the religated vector would generate a single band of 7.5 kb. I identified several clones with the desired mutant loxP site; one of these transformants is shown (Fig. 2, lane 4). This newly created pBeloBac11-loxP* vector is illustrated (Fig. 3).
Discussion
XhoI digests of the transformants resulting from the ligation of the mutant loxP oligonucleotide to pBeloBac11 demonstrated that the modified vector was generated. Nested deletions emanating from the mutant loxP site of the BAC clones from the pilot genomic library that was constructed in this study can be generated using the mini-transposon system that we employed earlier (Fig. 3) [6]. First, the mini-transposon vector containing the mutant loxP site must be transformed into the BAC clone of interest. Upon addition of IPTG, the mini-Tn10 transposon cassette will randomly integrate into the BAC clone. When these cells are infected with a lytic strain of the bacteriophage P1, then deletions will occur between the two mutant loxP sites as long as they are in the same orientation (Fig. 4) [5]. Alternatively, existing BAC clones can be digested with NotI to liberate the genomic DNA. Then the desired fragment could be ligated into NotI-digested pBeloBac11-loxP*. Deletions emanating from the wild-type loxP site can be generated using the transposon plasmid pTnPGKpuro/loxP-EBV; this would also modify the BAC clone so that it also can be propagated in mammalian cells since it would contain the Epstein Barr Virus (EBV) latent origin of replication oriP and the trans-activating gene EBNA-1 [9]. Utilization of this technology will allow researchers to identify both boundaries of cis-acting elements and genes.
Limitations