Skip to main content

Advertisement

Table 1 Microsatellite loci developed for (a) Promenetus exacuous and (b) Valvata tricarinata

From: Characterization of tri and tetra-nucleotide microsatellite loci for the freshwater snails Promenetus exacuous (Planorbidae) and Valvata tricarinata (Valvatidae) and their utility in population genetic studies

Locus Repeat motif Primer sequence (5′–3′) Label Allele range (bp) Round lake Lake Saratoga
n A HO/HE n A HO/HE
(a) Promenetus exacuous
 Pex216 (AAC)11 F: CAGTCGGGCGTCATCAACTTGGAATTGGCTGCCTC VIC 239–278 24 4 0.50/0.53 14 6 0.57/0.79
R: GCAAAGGCCGGATATTTCGATC
 Pex516 (AACT)18 F: CAGTCGGGCGTCATCACTGTCAGAAATACGCGGCTC 6-FAM 165–261 24 10 0.75/0.86 19 10 0.84/0.89
R: GGCGCGAAATGGACTAACTG
 Pex577 (AAT)10 F: GCTGTCTTTCATGGTTCCGG 6-FAM 243–276 23 1 0.00/0.00 17 4 0.41/0.47
R: CAGTCGGGCGTCATCAAATGTGTCTGCAGGCGTAC
 Pex757 (ACTC)11 F: TGAGAGCCCTTAAGTCGTGG 6-FAM 169–197 24 3 0.46/0.51 19 5 0.32/0.33
R: CAGTCGGGCGTCATCAGTCAGCTACGTGATCTTGGC
 Pex1009 (AAC)12 F: TTATTGCCACTCACGTACGC VIC 305–326 24 1 0.00/0.00 18 2 0.61/0.50
R: CAGTCGGGCGTCATCATTAACGGTTCTGGCTTCCAC
 Pex1877 (AACT)10 F: CAGTCGGGCGTCATCAGCTTTGGAGTATGCTTGCC NED 244–284 24 8 0.79/0.82 19 11 0.84/0.86
R: CTAAGATTGGGAAGCCGCTG
 Pex2091 (AGAT)16 F: CAGTCGGGCGTCATCAGAGTGTTTCGGTGCCACAG 6-FAM 272–368 24 15 0.88/0.91 18 15 0.94/0.94
R: AAATAGTGCCGAATGTGCCG
 Pex2117 (AACT)9 F: CAGTCGGGCGTCATCAACCTGCAAGAAAGACCTGC VIC 192–208 22 3 0.36*/0.63 6 3 0.33/0.70
R: CCTTTCCACCACATCACAGG
 Pex2181 (ACCT)11 F: CAGTCGGGCGTCATCAATGTAAGTGCGTGTGTAGCC VIC 86–162 24 2 0.17/0.22 18 9 0.89/0.84
R: ACTTCGCGTTTGTAGGTAGG
 Pex2263 (AAAG)15 F: CAGTCGGGCGTCATCAGCATCCATATTTCAAAGCTGGG PET 158–226 24 8 0.83/0.82 19 11 0.89/0.89
R: ACTGAAGTCCCTGAAGTGGC
 Pex2416 (ACT)9 F: CAGTCGGGCGTCATCATAGGGAGGCATACAAACGGAG NED 314 24 1 0.00/0.00 19 1 0.00/0.00
R: TTCGCTCAATACCCAGTGATC
 Pex2471 (ACC)8 F: AGGCAAACAGATGAGCTATGTC PET 146–170 22 1 0.00/0.00 18 5 0.56/0.68
R: CAGTCGGGCGTCATCATGGTACTGGGACTTCATGGC
 Pex2889 (AAAG)8 F: TACTGACTTGACGCCAATGC PET 250–262 24 1 0.00/0.00 18 4 0.50/0.51
R: CAGTCGGGCGTCATCAGTAGTCTAGGCCTTCGGTCC
 Pex2908 (ACCT)17 F: ACCTGCATGCCTAGCTACTG NED 128–184 24 7 0.96/0.79 19 12 0.95/0.90
R: CAGTCGGGCGTCATCATGTCATAAATCCGGCACTGC
 Pex2958 (AGAT)15 F: CAGTCGGGCGTCATCACTGCTATGGACGTGAGGGAG PET 248–384 23 13 0.95/0.91 18 23 0.94/0.97
R: TATTGATGGGCGGACGGATG
 Pex2972 (AACT)12 F: CAGTCGGGCGTCATCAGTCATCTACGCATGGGAAGC PET 166–226 24 5 0.79/0.80 18 11 0.76/0.85
R: GGCTTAAACTGGGACGATGC
(b) Valvata tricarinata
 Vtr99 (AATC)12 F: CAGTCGGGCGTCATCACAGAGGTTCAAATCCCGGC 6-FAM 266–318 24 6 0.33/0.34 24 14 0.92/0.90
R: AGTTGATCATCCCGCCGTAG
 Vtr115 (AGC)8 F: CTTTGCCTCTTCCGGACATG NED 127–163 24 8 0.58/0.73 24 6 0.71/0.76
R: CAGTCGGGCGTCATCACCTTCATTCCACCTCAGCAG
 Vtr565 (AAT)25 F: ACGGACTACAGGTGAATACAAC 6-FAM 186–270 23 7 0.65/0.85 23 19 0.96/0.95
R: CAGTCGGGCGTCATCAGAAGTTCAATTTCGGCATGAG
 Vtr828 (AAC)11 F: CAGTCGGGCGTCATCATCTAGGGAAAGCGTGAGTGG VIC 221–263 24 10 0.79/0.81 24 11 0.67/0.71
R: GCCCACTACAACAAGCGAAG
 Vtr835 (ACT)10 F: TGTCAGATCACTCTTGGGCG PET 203–224 24 2 0.08/0.08 24 5 0.42/0.59
R: CAGTCGGGCGTCATCAACAACCTAGTGTGCCCTTC
 Vtr972 (AAG)14 F: CTCGTTTCCTGGCTGTTGTC NED 127–169 24 7 0.67/0.61 24 7 0.67/0.76
R: CAGTCGGGCGTCATCATAGAGTCCAAGTGTGAGGCG
 Vtr980 (AAG)12 F: ACGCTAAGCTTTGTACAGTGC VIC 248–296 24 8 0.63/0.75 24 6 0.38/0.40
R: CAGTCGGGCGTCATCAGAGTACCATCAAAGACGGCG
 Vtr1099 (ATC)10 F: CAGTCGGGCGTCATCATTCAGTGCAGACATTCGGG VIC 258–279 24 3 0.58/0.55 24 5 0.46/0.52
R: CTGCAGCCTCGTGAATTGAC
 Vtr1279 (AAT)10 F: CAGTCGGGCGTCATCAGCGAAGACAGAAATCCTCC 6-FAM 141–348 24 8 0.67/0.76 24 13 0.75/0.81
R: ACAAATATATTTCGGTGCGCG
 Vtr1730 (AAG)19 F: CAGTCGGGCGTCATCATTGCTCCTTGGATTGGGATC VIC 182–236 24 10 0.83/0.77 24 9 0.58*/0.76
R: CAGCCCATTTCATCCTTGCC
 Vtr2328 (AAG)10 F: CCACAGGGCCAATAAATAACTG NED 103–118 24 2 0.29/0.25 22 3 0.45/0.59
R: CAGTCGGGCGTCATCATAGAGTCCAAGTGTGAGGCG
 Vtr2349 (AAAC)14 F: CAGTCGGGCGTCATCATGGGCACTGAAATCTCGTATG VIC 324–354 24 4 0.29/0.27 13 6 0.23*/0.79
R: CTTACGCCACTGCCACTAAC
 Vtr2388 (AAT)25 F: CAGGCCAAGATTCACACTGAC PET 190–235 24 9 0.75/0.80 24 8 0.67/0.87
R: CAGTCGGGCGTCATCAGTAACCCAGTCCGTGCTCG
 Vtr2492 (AAT)20 F: CAGTCGGGCGTCATCATCTCTGCCAGCTTACCACTG NED 227–314 24 14 0.83/0.92 24 10 0.67/0.84
R: GGACGTTGTGCTTCTATTCTCC
 Vtr2508 (AAT)9 F: CAGTCGGGCGTCATCATGTAGTGCCCATAGTCATGTAC PET 117–132 24 2 0.50/0.42 20 2 0.20/0.39
R: ACGCGTTCTCTTTAATACCTGC
 Vtr4154 (AAT)9 F: CAGTCGGGCGTCATCACCTACAGATCAGAGACGTACAC PET 209–221 24 2 0.04/0.04 24 4 0.63/0.56
R: TTGCAGATCAAGGTTGTCGC
 Vtr4287 (AGC)8 F: CAGTCGGGCGTCATCACCTTCATTCACCTCAGCAGC NED 126–162 24 8 0.71/0.75 24 5 0.75/0.75
R: CTTTGCCTCTTCCGGACATG
  1. Locus name is followed by repeat motif of sequenced allele, primer sequences, fluorescent dye label, total size range of alleles, and site-specific number of amplified individuals (n), number of alleles (A), and observed (HO)/expected (HE) heterozygosities. The 5′ primer tag is underlined and varied based on the 5′ beginning of the primer sequence. * Indicates statistically significant deviation from expected heterozygosity. GenBank Accession Numbers: P. exacuous MH000452–MH000467, V. tricarinata MH000435–MH000451