Skip to content

Advertisement

Open Access

Characterization of tri and tetra-nucleotide microsatellite loci for the freshwater snails Promenetus exacuous (Planorbidae) and Valvata tricarinata (Valvatidae) and their utility in population genetic studies

BMC Research Notes201811:204

https://doi.org/10.1186/s13104-018-3301-1

Received: 8 February 2018

Accepted: 20 March 2018

Published: 27 March 2018

Abstract

Objective

Promenetus exacuous and Valvata tricarinata are freshwater snail species with widespread distributions throughout North America. Information regarding their genetic diversity and population connectivity are currently lacking. We utilized next generation sequencing to develop the first microsatellites for each species to investigate genetic diversity within and differentiation among populations.

Results

Sixteen and seventeen microsatellite loci were developed for P. exacuous and V. tricarinata, respectively, and tested in a total of 43 P. exacuous and 48 V. tricarinata from two lakes approximately 183 km apart in New York State, USA. Fifteen P. exacuous loci were polymorphic in at least one lake and possessed 1–23 alleles and observed heterozygosities of 0.00–0.96 within individual lakes. Seventeen polymorphic V. tricarinata loci possessed 2–19 alleles and observed heterozygosities of 0.04–0.96 within lakes. Bayesian clustering using 12 loci for each species identified two distinct genetic populations, reflecting the two lakes. High assignment scores for individual snails to the lakes they were collected from supported strong population structure with minimal admixture at the scale of this study. These loci will be useful for investigating the genetic diversity and population structure of these species and indicate genetic differentiation may be common among their populations.

Keywords

Microsatellite loci Promenetus exacuous Valvata tricarinata Population geneticsGastropod genetic diversity

Introduction

Despite their diversity, importance to ecosystems, and conservation concerns, basic taxonomic and biological information is lacking for many freshwater gastropods throughout North America [1, 2]. We report here the development of independent sets of 16 and 17 microsatellite loci for two understudied species of freshwater gastropods, Promenetus exacuous (Say, 1821) and Valvata tricarinata (Say, 1817). Microsatellites were developed for these particular species for future studies comparing their genetic connectivity throughout New York State based on the species’ disjunct and often sympatric populations throughout the region, their phylogenetic divergence and differing biological characteristics offering comparative insights into gastropod population connectivity throughout New York, and their current lack of genetic data and available microsatellite loci [3]. In addition, both species have widespread distributions throughout North America and secure global conservation status with localized areas of concern, potentially increasing the interest of these microsatellites to other researchers [46].

Main text

Materials and methods

Valvata tricarinata and P. exacuous were collected from Round Lake (43° 02′ 55.6″N, 75° 58′ 24.1″W) and Lake Saratoga (43° 03′ 12.6″N, 73° 43′ 11.8″W) using dip nets. Both lakes are in New York State and are approximately 183 km apart. To develop microsatellite loci, genomic DNA for next generation sequencing was extracted from the foot of a single V. tricarinata from Round Lake and a single P. exacuous from Lake Saratoga using a Qiagen Dneasy® Tissue kit. DNA was eluted with 75 µl H2O and quantified using a NanoDrop 2000 (Thermo Scientific). Approximately 3 µg of RNA-free genomic DNA from each species was sent to the University of Wisconsin-Madison Biotechnology Center for DNA fragmentation and sequencing. Next generation sequencing was performed using an ION Torrent PGM system with each species allocated approximately 25% of a 318 chip. Raw genomic data were converted to FASTA format using Geneious ver. 8.1 [7]. Microsatellite motifs were identified using msatcommander 1.0.8 [8]. Parameters were set to search for perfect tri- and tetranucleotide repeats with a minimum length of eight repeat units to decrease the potential for genotyping errors due to stuttering common with dinucleotide repeats, and increase the likelihood of polymorphism [9, 10]. Primer %GC was set to 35–65%, optimal annealing temperature was 60 °C, and one primer from each pair was designed to have a 5′ CAG tag (CAGTCGGGCGTCATCA) (Table 1). Default settings were used for the remaining parameters.
Table 1

Microsatellite loci developed for (a) Promenetus exacuous and (b) Valvata tricarinata

Locus

Repeat motif

Primer sequence (5′–3′)

Label

Allele range (bp)

Round lake

Lake Saratoga

n

A

HO/HE

n

A

HO/HE

(a) Promenetus exacuous

 Pex216

(AAC)11

F: CAGTCGGGCGTCATCAACTTGGAATTGGCTGCCTC

VIC

239–278

24

4

0.50/0.53

14

6

0.57/0.79

R: GCAAAGGCCGGATATTTCGATC

 Pex516

(AACT)18

F: CAGTCGGGCGTCATCACTGTCAGAAATACGCGGCTC

6-FAM

165–261

24

10

0.75/0.86

19

10

0.84/0.89

R: GGCGCGAAATGGACTAACTG

 Pex577

(AAT)10

F: GCTGTCTTTCATGGTTCCGG

6-FAM

243–276

23

1

0.00/0.00

17

4

0.41/0.47

R: CAGTCGGGCGTCATCAAATGTGTCTGCAGGCGTAC

 Pex757

(ACTC)11

F: TGAGAGCCCTTAAGTCGTGG

6-FAM

169–197

24

3

0.46/0.51

19

5

0.32/0.33

R: CAGTCGGGCGTCATCAGTCAGCTACGTGATCTTGGC

 Pex1009

(AAC)12

F: TTATTGCCACTCACGTACGC

VIC

305–326

24

1

0.00/0.00

18

2

0.61/0.50

R: CAGTCGGGCGTCATCATTAACGGTTCTGGCTTCCAC

 Pex1877

(AACT)10

F: CAGTCGGGCGTCATCAGCTTTGGAGTATGCTTGCC

NED

244–284

24

8

0.79/0.82

19

11

0.84/0.86

R: CTAAGATTGGGAAGCCGCTG

 Pex2091

(AGAT)16

F: CAGTCGGGCGTCATCAGAGTGTTTCGGTGCCACAG

6-FAM

272–368

24

15

0.88/0.91

18

15

0.94/0.94

R: AAATAGTGCCGAATGTGCCG

 Pex2117

(AACT)9

F: CAGTCGGGCGTCATCAACCTGCAAGAAAGACCTGC

VIC

192–208

22

3

0.36*/0.63

6

3

0.33/0.70

R: CCTTTCCACCACATCACAGG

 Pex2181

(ACCT)11

F: CAGTCGGGCGTCATCAATGTAAGTGCGTGTGTAGCC

VIC

86–162

24

2

0.17/0.22

18

9

0.89/0.84

R: ACTTCGCGTTTGTAGGTAGG

 Pex2263

(AAAG)15

F: CAGTCGGGCGTCATCAGCATCCATATTTCAAAGCTGGG

PET

158–226

24

8

0.83/0.82

19

11

0.89/0.89

R: ACTGAAGTCCCTGAAGTGGC

 Pex2416

(ACT)9

F: CAGTCGGGCGTCATCATAGGGAGGCATACAAACGGAG

NED

314

24

1

0.00/0.00

19

1

0.00/0.00

R: TTCGCTCAATACCCAGTGATC

 Pex2471

(ACC)8

F: AGGCAAACAGATGAGCTATGTC

PET

146–170

22

1

0.00/0.00

18

5

0.56/0.68

R: CAGTCGGGCGTCATCATGGTACTGGGACTTCATGGC

 Pex2889

(AAAG)8

F: TACTGACTTGACGCCAATGC

PET

250–262

24

1

0.00/0.00

18

4

0.50/0.51

R: CAGTCGGGCGTCATCAGTAGTCTAGGCCTTCGGTCC

 Pex2908

(ACCT)17

F: ACCTGCATGCCTAGCTACTG

NED

128–184

24

7

0.96/0.79

19

12

0.95/0.90

R: CAGTCGGGCGTCATCATGTCATAAATCCGGCACTGC

 Pex2958

(AGAT)15

F: CAGTCGGGCGTCATCACTGCTATGGACGTGAGGGAG

PET

248–384

23

13

0.95/0.91

18

23

0.94/0.97

R: TATTGATGGGCGGACGGATG

 Pex2972

(AACT)12

F: CAGTCGGGCGTCATCAGTCATCTACGCATGGGAAGC

PET

166–226

24

5

0.79/0.80

18

11

0.76/0.85

R: GGCTTAAACTGGGACGATGC

(b) Valvata tricarinata

 Vtr99

(AATC)12

F: CAGTCGGGCGTCATCACAGAGGTTCAAATCCCGGC

6-FAM

266–318

24

6

0.33/0.34

24

14

0.92/0.90

R: AGTTGATCATCCCGCCGTAG

 Vtr115

(AGC)8

F: CTTTGCCTCTTCCGGACATG

NED

127–163

24

8

0.58/0.73

24

6

0.71/0.76

R: CAGTCGGGCGTCATCACCTTCATTCCACCTCAGCAG

 Vtr565

(AAT)25

F: ACGGACTACAGGTGAATACAAC

6-FAM

186–270

23

7

0.65/0.85

23

19

0.96/0.95

R: CAGTCGGGCGTCATCAGAAGTTCAATTTCGGCATGAG

 Vtr828

(AAC)11

F: CAGTCGGGCGTCATCATCTAGGGAAAGCGTGAGTGG

VIC

221–263

24

10

0.79/0.81

24

11

0.67/0.71

R: GCCCACTACAACAAGCGAAG

 Vtr835

(ACT)10

F: TGTCAGATCACTCTTGGGCG

PET

203–224

24

2

0.08/0.08

24

5

0.42/0.59

R: CAGTCGGGCGTCATCAACAACCTAGTGTGCCCTTC

 Vtr972

(AAG)14

F: CTCGTTTCCTGGCTGTTGTC

NED

127–169

24

7

0.67/0.61

24

7

0.67/0.76

R: CAGTCGGGCGTCATCATAGAGTCCAAGTGTGAGGCG

 Vtr980

(AAG)12

F: ACGCTAAGCTTTGTACAGTGC

VIC

248–296

24

8

0.63/0.75

24

6

0.38/0.40

R: CAGTCGGGCGTCATCAGAGTACCATCAAAGACGGCG

 Vtr1099

(ATC)10

F: CAGTCGGGCGTCATCATTCAGTGCAGACATTCGGG

VIC

258–279

24

3

0.58/0.55

24

5

0.46/0.52

R: CTGCAGCCTCGTGAATTGAC

 Vtr1279

(AAT)10

F: CAGTCGGGCGTCATCAGCGAAGACAGAAATCCTCC

6-FAM

141–348

24

8

0.67/0.76

24

13

0.75/0.81

R: ACAAATATATTTCGGTGCGCG

 Vtr1730

(AAG)19

F: CAGTCGGGCGTCATCATTGCTCCTTGGATTGGGATC

VIC

182–236

24

10

0.83/0.77

24

9

0.58*/0.76

R: CAGCCCATTTCATCCTTGCC

 Vtr2328

(AAG)10

F: CCACAGGGCCAATAAATAACTG

NED

103–118

24

2

0.29/0.25

22

3

0.45/0.59

R: CAGTCGGGCGTCATCATAGAGTCCAAGTGTGAGGCG

 Vtr2349

(AAAC)14

F: CAGTCGGGCGTCATCATGGGCACTGAAATCTCGTATG

VIC

324–354

24

4

0.29/0.27

13

6

0.23*/0.79

R: CTTACGCCACTGCCACTAAC

 Vtr2388

(AAT)25

F: CAGGCCAAGATTCACACTGAC

PET

190–235

24

9

0.75/0.80

24

8

0.67/0.87

R: CAGTCGGGCGTCATCAGTAACCCAGTCCGTGCTCG

 Vtr2492

(AAT)20

F: CAGTCGGGCGTCATCATCTCTGCCAGCTTACCACTG

NED

227–314

24

14

0.83/0.92

24

10

0.67/0.84

R: GGACGTTGTGCTTCTATTCTCC

 Vtr2508

(AAT)9

F: CAGTCGGGCGTCATCATGTAGTGCCCATAGTCATGTAC

PET

117–132

24

2

0.50/0.42

20

2

0.20/0.39

R: ACGCGTTCTCTTTAATACCTGC

 Vtr4154

(AAT)9

F: CAGTCGGGCGTCATCACCTACAGATCAGAGACGTACAC

PET

209–221

24

2

0.04/0.04

24

4

0.63/0.56

R: TTGCAGATCAAGGTTGTCGC

 Vtr4287

(AGC)8

F: CAGTCGGGCGTCATCACCTTCATTCACCTCAGCAGC

NED

126–162

24

8

0.71/0.75

24

5

0.75/0.75

R: CTTTGCCTCTTCCGGACATG

Locus name is followed by repeat motif of sequenced allele, primer sequences, fluorescent dye label, total size range of alleles, and site-specific number of amplified individuals (n), number of alleles (A), and observed (HO)/expected (HE) heterozygosities. The 5′ primer tag is underlined and varied based on the 5′ beginning of the primer sequence. * Indicates statistically significant deviation from expected heterozygosity. GenBank Accession Numbers: P. exacuous MH000452–MH000467, V. tricarinata MH000435–MH000451

DNA was extracted from 24 V. tricarinata snails from each lake and 24 and 19 P. exacuous from Round Lake and Lake Saratoga, respectively. For each DNA extraction, the foot was removed and transferred to 400 µl of 5% Chelex containing 0.1 mg/ml proteinase K. The solution was incubated for approximately 8 h at 60 °C followed by eight minutes at 95 °C. DNA was utilized directly from these extractions. Microsatellite loci were amplified using three primer polymerase chain reactions (PCRs) [11] on individual loci with the Qiagen Type-it Microsatellite Kit. Each 10 µl reaction included 1X Type-it Multiplex PCR (Qiagen) reaction mix, 0.2 µM standard locus primer, 0.02 µM locus primer with CAG tag sequence, and 0.2 µM fluorescent-labeled CAG tag (PET, NED, 6-FAM, or VIC). The parameters of the PCRs were 5 min heat activation at 95 °C followed by 30 cycles of denaturation at 95 °C for 30 s, annealing for 90 s, and an extension at 72 °C for 30 s. The 30 cycles were followed by a final extension of 30 min at 60 °C. An initial round of PCRs was performed with a gradient of annealing temperatures ranging from 50 to 70 °C to determine optimal annealing temperatures. All optimized loci utilized an annealing temperature of 60 °C, except Pex1877 and Pex2263 (56 °C), and Pex 216 (53 °C). Genotypes were determined on an ABI 3730 × 1 96-capillary Genetic Analyzer at the DNA Analysis Facility at Yale University. PCR products from up to four loci utilizing different fluorescent dyes were combined in each well prior to submission. Alleles were scored using Geneious ver. 8.1 [7].

MICRO-CHECKER ver. 2.2 [12] was used to identify potential scoring errors from stuttering, large allele dropout, and/or the presence of null alleles. Alleles were analyzed for deviations from Hardy–Weinberg expectations within sites and overall linkage disequilibrium using Genepop on the Web [13, 14]. Significance tests with multiple comparisons used an adjusted critical value based on the B-Y False Discovery Rate (FDR) [15]. STRUCTURE ver. 2.4.3 [16] was used to determine if loci could infer population differentiation by using genotypes to assign individuals to genetic clusters and estimate the actual number of genetic populations using a Bayesian approach. A highly conservative subset of twelve loci for each species that did not display deviations from Hardy–Weinberg expectations in either site, did not include loci displaying linkage with each other, and that failed to amplify in no more than two snails in either population (P. exacuous: Pex577, Pex757, Pex1009, Pex1877, Pex2091, Pex2181, Pex2263, Pex2471, Pex2889, Pex2908, Pex2958, and Pex2972; V. tricarinata: Vtr99, Vtr565, Vtr828, Vtr835, Vtr980, Vtr1099, Vtr1279, Vtr2328, Vtr2388, Vtr2492, Vtr4154, and Vtr4287) were used for STRUCTURE analyses. STRUCTURE runs used an admixture model with five iterations, a burnin length of 100,000 and 100,000 steps in the Monte Carlo Markov Chain (MCMC). Separate runs for each species utilized LnPD as the selection criterion and the number of genetic populations (K) was allowed to range from 1 to 6.

Results and discussion

Fifteen polymorphic P. exacuous loci possessed 1–23 alleles and observed heterozygosities ranged from 0.00 to 0.96 within individual lakes (Table 1). One locus deviated from Hardy–Weinberg expectations in Round Lake (Pex2117), potentially from null alleles and/or stuttering issues. Null alleles may also be present in Pex216 and Pex2117 in Lake Saratoga, with low amplification success likely prohibiting statistical significance. An additional sixteenth locus (Pex2416) was monomorphic in both populations, but is reported here as it may be polymorphic in other populations as observed between populations with several similar loci in the present study. Linkage disequilibrium was not detected between any pair of P. exacuous loci.

Seventeen polymorphic V. tricarinata loci possessed 2–19 alleles and observed heterozygosities of 0.04–0.96 within lakes (Table 1). Two loci deviated from Hardy–Weinberg expectations in Lake Saratoga (Vtr1730 and Vtr2349), potentially due to null alleles. Null alleles may also be present in Vtr2508 in Lake Saratoga. Linkage disequilibrium was detected among Vtr115, Vtr972, and Vtr4287.

STRUCTURE results for both species supported two genetic populations (K = 2), reflecting the two sample locations (Fig. 1). All snails were assigned to the population they were sampled from with a high probability (97–100% for all snails except a single V. tricarinata from Lake Saratoga with 92%), revealing minimal admixture between these populations for both species (Fig. 1). The high assignment values reveal that these loci will be suitable for identifying gene flow patterns among populations experiencing varying levels of admixture. Multiple genetic groups were not detected within sites.
Figure 1
Fig. 1

Results of STRUCTURE cluster membership analyses for a Promenetus exacuous and b Valvata tricarinata for K = 2. Vertical bars represent proportion of membership of individual snails for two genetic clusters (gray = Round Lake, black = Lake Saratoga). Labels below graphs indicate original sample sites

The development of microsatellites in these two understudied, distantly related species will enable researchers to examine the factors impacting the genetic diversity within and population structure among their populations, and gain additional insights into the biology, evolution, and conservation of freshwater gastropods. While our interests are primarily the dispersal and connectivity of these species throughout New York State and surrounding areas, these microsatellites may be used by other labs to address diverse questions in other regions. For example, although both species are globally secure, there are conservation concerns for specific populations throughout their range [46], and these markers may aid in conservation efforts. In addition, direct comparison of gastropods from different families over large geographic areas may reveal broad evolutionary dispersal patterns.

Limitations

Due the potential for variation in regions flanking microsatellite loci and the relatively widespread distribution of both species, some of these loci may not amplify in populations throughout their range.

Abbreviations

PCR: 

polymerase chain reaction

FDR: 

false discovery rate

K: 

number of genetic populations

NCBI: 

National Center for Biotechnology Information

n

number of amplified individuals

A: 

number of alleles

HO

observed heterozygosity

HE

expected heterozygosity

Declarations

Authors’ contributions

PY and DBK participated in all aspects of data collection, data analyses, and manuscript preparation. Both authors read and approved the final manuscript.

Acknowledgements

The author(s) thank the University of Wisconsin Biotechnology Center DNA Sequencing Facility for providing next generation genomic DNA sequencing facilities and services and Yale University’s DNA Analysis Facility on Science Hill for genotyping services.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The microsatellite sequences generated from this study are available through NCBI’s GenBank (https://www.ncbi.nlm.nih.gov/nucleotide/) and are accessible via the GenBank Accession Numbers MH000435–MH000467).

Consent for publication

Not applicable.

Ethics approval and consent to participate

All applicable national, international, state, and institutional guidelines for the care and use of animals were followed. Collection permits were obtained from the New York Department of Environmental Conservation (#1674) and New York State Office of Parks, Recreation and Historic Preservation (#2011-GL-006).

Funding

Funding was provided by Le Moyne College’s Research and Development Committee.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Biological and Environmental Sciences, Le Moyne College, Syracuse, USA

References

  1. Perez KE, Minton RL. Practical applications for systematics and taxonomy in North American freshwater gastropod conservation. J N Am Benthol Soc. 2008;27:471–83.View ArticleGoogle Scholar
  2. Johnson PD, Bogan AE, Brown KM, Burkhead NM, Cordeiro JR, Garner JT, Hartfield PD, Lepitzki DAW, Mackie GL, Pip E, Tarpley TA, Tiemann JS, Whelan NV, Strong EE. Conservation status of freshwater gastropods of Canada and the United States. Fisheries. 2013;38:247–82.View ArticleGoogle Scholar
  3. Jokinen EH. The freshwater snails (Mollusca: Gastropoda) of New York State. New York: State Museum Bulletin; 1992. p. 482.Google Scholar
  4. Sutter JV, Andersen ME, Bunnell KD, Canning MF, Clark AG, Dolsen DE, Howe FP. Utah comprehensive wildlife conservation strategy (CWCS). Salt Lake City: Utah Division of Wildlife Resources; 2005.Google Scholar
  5. Pyron M, Beugly J, Martin E, Spielman M. Conservation of the freshwater gastropods of Indiana: historic and current distributions. Am Malacol Bull. 2008;26:137–51.View ArticleGoogle Scholar
  6. Natureserve. NatureServe Explorer: An online encyclopedia of life. Version 7.1. NatureServe, Arlington, Virginia. 2017. http://explorer.natureserve.org. Accessed 11 Jan 2018.
  7. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Mentjies P, Drummond A. Geneious basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28:1647–9.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Faircloth BC. MSATCOMMANDER: detection of microsatellite repeat arrays and automated, locus-specific primer design. Mol Ecol Resour. 2008;8:92–4.View ArticlePubMedGoogle Scholar
  9. Buschiazzo E, Gemmell NJ. The rise, fall and renaissance of microsatellites in eukaryotic genomes. BioEssays. 2006;28:1040–50.View ArticlePubMedGoogle Scholar
  10. Zalapa JE, Cuevas H, Zhu H, Steffan S, Senalik D, Zeldin E, Mccown B, Harbut R, Simon P. Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences. Am J Bot. 2012;99:193–208.View ArticlePubMedGoogle Scholar
  11. Schuelke M. An economic method for the fluorescent labeling of PCR fragments. Nat Biotechnol. 2000;18:233–4.View ArticlePubMedGoogle Scholar
  12. Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes. 2004;4:535–8.View ArticleGoogle Scholar
  13. Raymond M, Rousset F. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Hered. 1995;86:248–9.View ArticleGoogle Scholar
  14. Rousset F. Genepop’007: a complete reimplementation of the Genepop software for Windows and Linux. Mol Ecol Resour. 2008;8:103–6.View ArticlePubMedGoogle Scholar
  15. Narum SR. Beyond Bonferroni: less conservative analyses for conservation genetics. Conserv Genet. 2006;7:783–7.View ArticleGoogle Scholar
  16. Pritchard JK, Stephens M, Donnelly P. Inference of population structure using multilocus genotype data. Genetics. 2000;155:945–59.PubMedPubMed CentralGoogle Scholar

Copyright

© The Author(s) 2018

Advertisement