Skip to main content

The role of insulin receptor substrate 1 gene polymorphism Gly972Arg as a risk factor for ischemic stroke among Indonesian subjects



The identification of new genetic-associated risk factor of ischemic stroke could improves strategies for stroke prevention. This study aims to identify insulin receptor substrate 1 (IRS-1) gene polymorphism Gly972Arg as the risk factor for ischemic stroke among Indonesian subjects. The case–control study was conducted by matching the gender and race on 85 cases of patients with ischemic stroke and 86 healthy non-stroke control subjects. Ischemic stroke was established by the complete neurology examination and brain computed tomography scan or magnetic resonance imaging. Polymerase chain reaction–Restriction Fragment Length Polymorphism was performed to analyze IRS-1 gene Gly972Arg genotype.


There were 85 ischemic stroke cases and 86 control subjects. The distribution of nucleotide IRS-1 gene polymorphism Gly972Arg in the ischemic stroke vs health controls for GG were 32.2% vs 41.5%, for GR were 16% vs 7.6%, and for RR were 0.5% vs 1.9%. IRS-1 gene polymorphism Gly972Arg was found as significant risk factor for ischemic stroke [odds ratio of 2.6 (1.27–5.27); CI 95%, p = 0.008]. Conclusively, the IRS-1 gene polymorphism Gly972Arg should be considered as an important factor in the prevention and treatment of ischemic stroke.


Substantial genetic component defects exist in ischemic stroke. The identification of new genetic-related risk factor for ischemic stroke is needed to improve stroke prevention strategies and determine the potential target of the ischemic stroke treatment.

Hypertension, diabetes mellitus, heart disease, history of TIA (transient ischemic attack) and stroke history have long been recognized as major risk factors of stroke [1, 2]. Furthermore, metabolic syndrome and insulin resistance are closely related with the incidence of stroke [3,4,5,6,7].

The prevalence of the metabolic syndrome is high among men and women [8]. As an indicator of insulin resistance, the insulin receptor substrate 1 (IRS-1) has been associated to ischemic stroke [9]. The IRS-1 polymorphisms has been linked to high platelet reactivity in coronary artery disease (CAD) patients with type 2 diabetes mellitus (T2DM) [10, 11]. It has been reported that IRS-1 polymorphism genotype Gln192Arg is associated with the increased incidence of ischemic stroke [12]. Moreover, phosphodiesterase 4D (PDE4D) [13], and 5-lipoxygenase gene activating protein (ALOX5AP) [14], were shown to be significantly related with ischemic stroke due to progressive changes in the walls of blood vessels resulting in the increased atherosclerosis process. These studies suggest that human gene variation that contributed to the pathogenesis of stroke is crucial to be considered in the prevention and treatment of the disease [15].

Metabolic syndrome is consists of abdominal obesity, hyperglycemia, insulin resistance, hypertriglyceridemia, low HDL cholesterol and hypertension and is an important risk factor for atherosclerotic cardiovascular disease [16]. The most commonly detected polymorphism in IRS-1 is a glycine to arginine change at codon 972 (Gly972Arg) [17]. Previous study found that metabolic syndrome is related with IRS-1 gene polymorphism Gly972Arg [18].

The current study addresses the question on whether IRS-1 gene polymorphism Gly972Arg acts as the risk factor for ischemic stroke among Indonesian subjects.

Main text

Materials and methods

This is a case control study by matching the gender and race of cases of ischemic stroke with healthy non-stroke control subjects. The inclusion criteria for ischemic stroke patients was acute ischemic stroke cases with onset of stroke within 7 days, aged 35–75 year old, Malay race, and treated in the Dr. Zainoel Abidin Hospital, Banda Aceh, Indonesia, and provided written consent to be enrolled in the study. The controls were healthy participants not suffering from stroke, without history of stroke and without family history of stroke who were willing to follow the study by signing the informed consent.

Subjects underwent the following procedures: general physical examination; complete neurological examination; non-contrast brain computed tomography (CT) scan or non-contrast magnetic resonance imaging (MRI) to confirm ischemic stroke. The CT scanner system used was SOMATOM Sensation 64-slice CT scanner and the MRI system used was 3T Magnetom (Siemens Healthcare Corp, Erlangen, Germany). Hypodense lesion from brain CT scan or hypointense lesion from MRI were considered as positive results for cerebral infarct, DNA isolation was performed and followed by Polymerase chain reaction–Restriction Fragment Length Polymorphism (PCR–RFLP) screening using the enzyme SmaI for genotype analysis of IRS-1 gene Gly972Arg. The forward primer 5′CTTCTGTCAGGTGTCCATCC3′ forward and reverse primer 5′TGGCGAGGTGTCCACGTAGC3′ used in this study were designed by the Primer BLAST with NCBI Reference Sequence Number: NM_005544.2 ( Change of nucleotide GGG to become RGG is defined as IRS-1 gene polymorphism Gly972Arg. For the control subjects, the same procedures were performed except for the brain CT scan or MRI.

Data was subject to statistical analysis by using Statistical Package for the Social Sciences (SPSS) Windows software ver. 19.0 (Chicago, IL, USA). Bivariate categorical data was statistically analyzed by Chi squared test. Odds ratio (OR) with 95% of confidence interval (CI) was calculated to show association between variables. P < 0.05 was considered to be statistically significant.


This study involved 85 cases with ischemic stroke with the mean age of 57.3 years, and 86 control subjects with mean age of 44.2 years. The distribution of nucleotide IRS-1 gene polymorphism Gly972Arg in the ischemic stroke vs health controls for GG were 32.2% vs 41.5%, for GR were 16% vs 7.6%, and for RR were 0.5% vs 1.9%.

We performed the electrophoresis PCR–RFLP examination to determine the gene IRS-1 polymorphism Gly972Arg in some of the ischemic stroke cases as illustrated in Fig. 1. The length of DNA amplification was 263 base pairs (bp). By using the SmaI enzyme-mediated restriction, the DNA amplification would be cut into three bands called normal genotype (GG) consisting of the band of 155 bp band, 80 bp band and 28 bp band. Meanwhile, the genotype mutant heterozygote (GR) consisted of four bands: 183 bp; 155 bp; 80 bp; and; 28 bp. In addition, the genotype mutant heterozygote (RR) consisted of two bands: 183 bp, and; 80 bp.

Fig. 1

The result of the electrophoresis PCR–RFLP examination of IRS-1 Gene Polymorphism Gly972Arg. RFLP was conducted with SmaI restriction enzymes Sma1. Path 1: Marker ladder 50, Path 2: Control (+), Path 3, 4, 5, 7: GG Genotype, Path 6: GR Genotype, Path 8: RR Genotype

Several representative subjects’ samples (subject number 9, 29, 46, and 48) were analyzed by sequence analysis to confirm the results of PCR–RFLP examination. We confirmed that PCR–RFLP results were consistent with the results of the IRS-1 gene sequence analysis (Additional file 1). Furthermore, the electrophoresis image for each PCR–RFLP results were considered to be accepted, namely the genotype sample number 9 (GG), 29 (GG), 46 (GG) and 48 (GR).

Next, we statistically analyzed the role of IRS-1 gene polymorphism Gly972Arg as the factor risk for ischemic stroke (Table 1). We found that IRS-1 gene polymorphism Gly972Arg was a significant risk factor for ischemic stroke.

Table 1 The role of IRS-1 gene polymorphism Gly972Arg as a risk factor for ischemic stroke

Finally, we determined the relationship between G972 and R972 alleles of gene IRS-1 with ischemic stroke as described in Table 2. The R972 allele (mutant) was significantly related to stroke ischemic (p = 0.008), whereas G972 allele (normal) showed no significant relationship.

Table 2 The R972 alleles of gene IRS-1 is significantly associated with ischemic stroke


The investigation of potential detectable biomarker as risk factor in order to determine necessary primary prevention of stroke is crucial. This study shows that IRS-1 gene polymorphism Gly972Arg acts as the risk factor for ischemic stroke. Pathogenesis and molecular changes occurring in IRS-1 gene polymorphism Gly972Arg acting as the factor for ischemic stroke take place because of a mutation of the amino acid glycine by arginine at codon 972 substitution (G972R) [19]. This mutation resulted in the declined insulin sensitivity [20]. IRS-1 protein is expressed in the tissue and is very sensitive to insulin with a critical role in modulating the effect of insulin [21, 22]. Once attached to the insulin receptor, the specific tyrosine residues of IRS-1 protein will be phosphorylated which mediates insulin-controlled variety of cell functions, growth and metabolism [21, 23, 24]. Other study showed that IRS-1 gene Gly972Arg mutation has a strong relationship with the environment and genetic factor [25].

It has been previously reported that some of IRS-1 gene variants increases the risk of metabolic syndrome [26]. The pathogenesis of ischemic stroke due to metabolic disorders and insulin resistance is begun from changes at the cellular level with the glucose transporter type 4 (GLUT-4) translocation mechanism and the path of insulin transporter regulating the glucose metabolism within cells [27].

Botnia study showed around 10% of the population with normal glucose tolerance, 40% of glucose intolerance and 70% patients with DM-2 experiencing metabolic syndrome [28]. Metabolic syndrome increases the risk up to three times for heart coronary disease, myocardial infarction and stroke [29]. The insulin resistance underlies the pathological process of metabolic syndrome. Glucose intolerance and insulin resistance are estimated to cause hypertension, microalbuminuria, dyslipidemia and sympathetic hyperactivity of the nervous system [30].

IRS that phosphorylated in multiple residual tyrosines are the candidate of the genetic insulin resistance [31]. Polymorphism of two amino acids can be described in the IRS-1 gene that is insulin-sensitive and in the insulin-like growth factor 1 (IGF1) sensitive tissues. In one study, from 86 patients without relationship with NIDDM and 76 normoglycemic control, 10 subjects were shown to have NIDDM and three controls experience heterozygous polymorphism in codon 972 with glycine substituted by arginine [32].

Impaired IRS act as a mediator of signal transduction that contributed in the insulin resistance. IRS-1 phosphorylation on serine 307 occurred because of protein kinase/c-Jun N-terminal kinase (SAPK/JNK) activation as the critical part for the molecular change that leads to insulin resistance [33]. The inhibitor serine phosphorylase is the potential molecular mechanism of insulin resistance [34]. The combination of p85alpha and the increase in serine phosphorylation from IRS-1 will accelerate pathogenesis of insulin resistance [35].

To the best of our knowledge, this study is the first to report the role of IRS-1 gene polymorphism Gly972Arg as a significant risk factor for ischemic stroke in Indonesian subjects.


The nature of the case–control design in this study is not establishing cause and effect relationship. Although IRS-1 gene polymorphism Gly972Arg might serve as a predictor for ischemic stroke in the future, it is difficult to be considered as actionable target.


  1. 1.

    Millikan C, McDowell F, Easton JD. Risk factors in stroke (stroke profile) in stroke. Philadelphia: Lea & Febiger; 1987.

    Google Scholar 

  2. 2.

    Schulte B. Neuroepidemiology of cerebrovascular disease: an overview. In: Copra JSJK, Sawhney IMS, editors. Advances in neurology. Amsterdam: Excerpta Medica; 1990.

    Google Scholar 

  3. 3.

    Ninomiya J, L’italien G, Criqui MH, Whyte JL, Gamst A, Chen RS. Association of the metabolic syndrome with history of myocardial infarction and stroke in the third national health and nutrition examination survey. Circulation. 2004;109:42–6.

    Article  PubMed  Google Scholar 

  4. 4.

    Rutter M, Meigs JB, Sullivan LM, Dagostino RB, Wilson P. Insulin resistance, the metabolic syndrome, and incident cardiovascular events in the Framingham offspring study. Diabetes. 2005;54:3252–7.

    CAS  Article  PubMed  Google Scholar 

  5. 5.

    Dallongeville J, Gruppose MC, Cottel D, Forrieres J, Arveiler J, Bingham A, et al. Association between the metabolic syndrome and parental history of premature cardiovascular disease. Eur Heart J. 2006;9:1–7.

    Article  Google Scholar 

  6. 6.

    Paek K, Chun KH, Lee KW. Relationship between metabolic syndrome and familial history of hypertension/stroke, diabetes, and cardiovascular disease. J Korean Med Sci. 2006;21:701–8.

    Article  PubMed  PubMed Central  Google Scholar 

  7. 7.

    Misra A, Misra R, Wijesuriya M, Banerjee D. The metabolic syndrome in South Asians: continuing escalation & possible solutions. Indian J Med Res. 2007;125:345–54.;year=2007;volume=125;issue=3;spage=345;epage=354;aulast=Misra;type=0. Accessed 28 Aug 2013.

  8. 8.

    Ford ES, Giles WH, Dietz WH. Prevalence of the metabolic syndrome among US adults: findings from the Third National Health and Nutrition Examination Survey. JAMA. 2002;287:356–9.

    Article  Google Scholar 

  9. 9.

    Bacci S, Prudente S, Copetti M, Spoto B, Rizza S, Baratta R, et al. Joint effect of insulin signaling genes on cardiovascular events and on whole body and endothelial insulin resistance. Atherosclerosis. 2013;226(1):140–5.

    CAS  Article  PubMed  Google Scholar 

  10. 10.

    Zhang D, Zhang X, Liu D, Liu T, Cai W, Yan C, et al. Association between insulin receptor substrate-1 polymorphisms and high platelet reactivity with clopidogrel therapy in coronary artery disease patients with type 2 diabetes mellitus. Cardiovasc Diabetol. 2016;15:50.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  11. 11.

    Angiolillo DJ, Bernardo E, Zanoni M, Vivas D, Capranzano P, Malerba G, et al. Impact of insulin receptor substrate-1 genotypes on platelet reactivity and cardiovascular outcomes in patients with type 2 diabetes mellitus and coronary artery disease. J Am Coll Cardiol. 2011;58(1):30–9.

    CAS  Article  PubMed  Google Scholar 

  12. 12.

    Ranade K, Kirchgessner TG, Iakoubova OA, Devlin JJ, Delmonte T, Vishnupad P. Evaluation of the paraoxonases as candidate genes for stroke: Gln192Arg polymorphism in the paraoxonase 1 gene is associated with increased risk of stroke. Stroke. 2005;36:2346–50.

    CAS  Article  PubMed  Google Scholar 

  13. 13.

    Alberts M. Genetics of cerebrovascular disease. Stroke. 2004;35:342–4.

    Article  PubMed  Google Scholar 

  14. 14.

    Lohmussaar E, Gschwendtner A, Mueller JC, Org T, Wichmann E, Hamann G, et al. ALOX5AP gene and the PDE4D gene in a Central European population of stroke patients. Stroke. 2005;36:731–6.

    CAS  Article  PubMed  Google Scholar 

  15. 15.

    Rosand J, Altshuler D. Human genome sequence variation and the search for genes influencing stroke. Stroke. 2003;34:2512–6.

    CAS  Article  PubMed  Google Scholar 

  16. 16.

    Grundy S. Metabolic syndrome pandemic. Arteroscler Thromb Vasc Biol. 2008;28:27–38.

    Article  Google Scholar 

  17. 17.

    McGettrick AJ, Feener EP, Kahn CR. Human insulin receptor substrate-1 (IRS-1) polymorphism G972R causes IRS-1 to associate with the insulin receptor and inhibit receptor autophosphorylation. J Biol Chem. 2005;280(8):6441–6.

    CAS  Article  PubMed  Google Scholar 

  18. 18.

    Sesti G, Federici M, Hribal ML, Lauro D, Sbraccia P, Lauro R. Defect of insulin receptor substrate (IRS) system in human metabolic disorders. FASEB J. 2001;15:2099–111.

    CAS  Article  PubMed  Google Scholar 

  19. 19.

    Hitman G, Hawrami K, Mccarthy MI, Viswanathan M, Snehalatha C, Ramachandran A, et al. Insulin receptor substrate-1 gene mutations in NIDDM; implications for the study of polygenic disease. Diabetologia. 1995;38:481–6.

    CAS  Article  PubMed  Google Scholar 

  20. 20.

    Clausen JO, Hansen T, Bjørbaek C, Echwald SM, Urhammer SA, Rasmussen S, Andersen CB, Hansen L, Almind K, Winther K, et al. Insulin resistance: interactions between obesity and a common variant of insulin receptor substrate-1. Lancet. 1995;346(8972):397–402.

    CAS  Article  PubMed  Google Scholar 

  21. 21.

    Sun X, Rothemberg P, Khan CR, Backer JM, Araki E, Wilden PA, et al. Structure of the insulin receptor substrate IRS-1 defines a unique signal transduction protein. Nature. 1991;352:73–7. Accessed 28 Aug 2013.

    CAS  Article  Google Scholar 

  22. 22.

    Kahn C. Insulin action, diabetogenes and the cause of type II diabetes. Diabetes. 1994;43:1066–84.

    CAS  Article  PubMed  Google Scholar 

  23. 23.

    Meyers M, White MF. The new elements of insulin signaling: insulin receptor substrate-1 and proteins with SH2 domains. Diabetes. 1993;42:643–50.

    Article  Google Scholar 

  24. 24.

    Kanai F, Ito K, Todaka M, Hayashi H, Kamohara S, Ishii K, et al. Insulin-stimulated GLUT4 translocation is relevant to the phosphorylation of IRS-1 and the activity of PI-3 kinase. Biochem Biophys Res Commun. 1993;195:762–8.

    CAS  Article  PubMed  Google Scholar 

  25. 25.

    Strohmer B, Reiter R, Holzl B, Paulwebber B. Lack of association of the Gly972Arg mutation of the insulin receptor substrate-1 gene with coronary artery disease in the Austrian population. J Intern Med. 2004;255:146–7.

    CAS  Article  PubMed  Google Scholar 

  26. 26.

    Kilpeläinen TO, Zillikens MC, Stančákova A, Finucane FM, Ried JS, Langenberg C. Genetic variation near IRS1 associates with reduced adiposity and an impaired metabolic profile. Nat Genet. 2011;43(8):753–60.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  27. 27.

    Epstein F. Glucose transporters and diabetes action. Implications for insulin resistance and diabetes mellitus (Mechanisms of Disease). N Eng J Med. 1999;341:248–57.

    Article  Google Scholar 

  28. 28.

    Lindgren CM, Mahtani MM, Widén E, McCarthy MI, Daly MJ, Kirby A, et al. Genomewide search for type 2 diabetes mellitus susceptibility loci in Finnish families: the Botnia study. Am J Hum Genet. 2002;70:509–16.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  29. 29.

    Groop L. Genetics of the metabolic syndrome. Br J Nutr. 2000;83:S39–48.

    CAS  Article  PubMed  Google Scholar 

  30. 30.

    Zwieten P, Mancia G. Waist circumference. The metabolic syndrome. Amsterdam: McKinley Health Care; 2006.

    Google Scholar 

  31. 31.

    Boucher J, Kleinridders A, Kahn CR. Insulin receptor signaling in normal and insulin-resistant states. Cold Spring Harb Perspect Biol. 2014;6(1):a009191.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  32. 32.

    Almind K, Bjorbaek C, Vestergaard H, Hansen T, Echwald S, Pedersen O. Amino acid polymorphism of insulin receptor substrate-1 in noninsulin-dependent diabetes mellitus. Lancet. 1993;342:828–32.

    CAS  Article  PubMed  Google Scholar 

  33. 33.

    Sugita M, Sugita H, Kaneki M. Increased insulin receptor substrate 1 serine phosphorylation and stress-activated protein kinase/c-Jun N-terminal kinase activation associated with vascular insulin resistance in spontaneously hypertensive rats. Hypertension. 2004;44:484–9.

    CAS  Article  PubMed  Google Scholar 

  34. 34.

    Werner ED, Lee J, Hansen L, Yuan M, Shoelson SE. Resistance due to phosphorylation of insulin receptor substrate-1 at serine 302. J Biol Chem. 2004;279:35298–305.

    CAS  Article  PubMed  Google Scholar 

  35. 35.

    Draznin B. Molecular mechanisms of insulin resistance: serine phosphorylation of insulin receptor substrate-1 and increased expression of p85alpha: the two sides of a coin. Diabetes. 2006;55:2392–7.

    CAS  Article  PubMed  Google Scholar 

Download references

Authors’ contributions

S contributed in the study concept, design, literature search, clinical studies, data acquisition, data analysis, statistical analysis, manuscript preparation, and final approval of the manuscript. SW contributed in the study design, data analysis, manuscript editing, and final approval of the manuscript. SM contributed in the laboratory experimental procedures, data acquisition, data analysis, statistical analysis, manuscript preparation, and final approval of the manuscript. IA contributed in the laboratory experimental procedures, data analysis, statistical analysis, manuscript editing, manuscript review, and final approval of the manuscript. FN contributed in the literature search, data analysis, statistical analysis, manuscript editing, manuscript review, and final approval of the manuscript. All authors read and approved the final manuscript.



Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The data set supporting the conclusions of this article can be obtained from the authors upon reasonable request.

Consent to publish

Not applicable.

Ethics approval and consent to participate

The study has been approved by the Institutional Review Board (IRB) of Universitas Gadjah Mada, Yogyakarta, Indonesia (Ethical Clearance No. 063/KE/FK/2011) and all subjects provided written informed consent to participate in this study.



Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Author information



Corresponding author

Correspondence to Fariz Nurwidya.

Additional file

Additional file 1.

The result of the sequence analysis of several sample research to identify IRS-1 gene polymorphism Gly972Arg. (A) Image A shows locust 972 where mutation G → R frequently occurs. (B) Image B shows locust 324 where in the sequence of amino acid group Lysine to Arginine mutation.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Syahrul, Wibowo, S., Haryana, S.M. et al. The role of insulin receptor substrate 1 gene polymorphism Gly972Arg as a risk factor for ischemic stroke among Indonesian subjects. BMC Res Notes 11, 718 (2018).

Download citation


  • Ischemic stroke
  • Metabolic syndrome
  • Insulin resistance
  • IRS-1 gene polymorphism Gly972Arg