Skip to main content
Download PDF
  • Research note
  • Open access
  • Published:

Comparative evaluation of BMI-1 proto-oncogene expression in normal tissue, adenoma and papillary carcinoma of human thyroid in pathology samples

BMC Research Notes volumeĀ 14, ArticleĀ number:Ā 369 (2021) Cite this article

Abstract

Objective

Papillary Thyroid carcinoma accounts for more than 60% of adult thyroid carcinomas. Finding a helpful marker is vital to determine the correct treatment approach. The present study was aimed to evaluate the expression of the B cell-specific Moloney murine leukemia virus integration site 1 (BMI-1) gene in papillary carcinoma, adenoma, and adjacent healthy thyroid tissues. Pathology blocks of thyroid tissues at the pathology department of patients who have undergone thyroid surgery between 2015 and 2019 were examined; papillary carcinoma, adenoma, and healthy tissues were selected and sectioned. Total RNA was extracted, and the relative expression level of the BMI-1 gene was examined using the Real-Time qPCR method.

Results

In the papillary and adenoma tissues, BMI-1 was overexpressed (1.047-fold and 1.042-fold) in comparison to healthy tissues (pā€‰<ā€‰0.05 for both comparisons). However, no statistically significant differences were observed between adenoma and papillary carcinoma tissues regarding BMI-1 gene expression. This study demonstrated a new biomarker for thyroid malignancies and found that the mRNA levels of the BMI-1 gene were higher in tumor tissues compared with healthy tissues. Further studies are needed to evaluate the BMI1 gene expression in other thyroid cancers.

Introduction

Although thyroid cancers represent only 1% of total diagnosed tumors annually, it is still the most common endocrine glandsā€™ malignancy [1]. According to recent reports, thyroid cancers account for 2.3% of new cancer cases in Iran [2]. WHO studies have revealed that thyroid cancers are far more common among women (230,000 new cases annually) compared with men (70,000 new cases annually) [3]; moreover, thyroid cancers are the 7th commonly diagnosed malignancy in women and the 14th commonly diagnosed malignancy in men among Iranians [4, 5].

Thyroid cancersā€™ etiology has been investigated in numerous studies. Some contributing factors to thyroid cancer include exposure to ionizing radiation, goiter and benign nodules/adenomas, lifestyle (smoking and dietary habitats), and exposure to toxic chemicals [6, 7]. Thyroid carcinomas are classified into four main categories: Papillary, Follicular, Medullary, and Anaplastic carcinomas. The first two types of thyroid cancer account for more than 90% of the cases and have a higher treatment rate [8]. Although disease-related mortality of papillary thyroid carcinoma occurs mainly in patients in stage IV of papillary thyroid carcinoma, these patients represent a minority of patients [9].

Early diagnosis and treatment of thyroid tumors may prevent the involvement of the cervical lymph nodes [10, 11]. It has been reported that neck lymph nodes are involved in 46% of papillary thyroid carcinomas at initial diagnosis, though the proper treatment leads to long-time survival [12]. Even though advanced laboratory diagnosis of cancers has improved the technological ability for earlier diagnosis of silent thyroid tumors, the need for predictive markers is critical for selecting individuals with increased risk of thyroid carcinomas [13].

Recent studies have reported that B cell-specific Moloney murine leukemia virus integration site 1 (BMI-1), a transcription factor involved in regulating cell cycle and apoptosis, is upregulated in various cancers and related to poor prognosis [14, 15]. Interaction of p16 (a tumor suppressor encoded by the INK4a/Arf locus) and BMI-1 contribute stem cell-like features to cancerous cells and alter the biological behavior of tumors [16]. In addition, down-regulation of BMI-1 in breast cancer cells inhibited cellular invasion and proliferation [17]. Several studies have suggested the overexpression of the BMI-1 gene as a predictive marker of cancer initiation [18, 19]. Moreover, upregulation of BMI-1 has been linked to tumor relapse, metastasis, and resistance to therapy in multiple human cancers [20].

Consequently, the present study is aimed to investigate the level of expression of the BMI-1 gene in human adenoma, papillary thyroid carcinomas, and their healthy adjacent tissue samples. The present study is the first report of the expression of BMI-1 in thyroid cancerous and healthy adjacent tissues to the best of our knowledge.

Main text

Materials and methods

Tissue sample preparation and ethical statements

Paraffin blocks of thyroid specimens surgically excised from 21 patients from 2015 to 2019 and achieved at the pathology department of Seied-o-Alshohada Hospital were used in the present study. Written informed consents were obtained from all patients before surgical procedures. Three specimen blocks were prepared for each patient, including papillary carcinoma, adenoma, and adjacent healthy tissues; the specimens were recovered, and 10Ā Ī¼M sections were prepared after slide microscopy observations and confirmation of thyroid papillary carcinoma diagnosis.

Inclusion and exclusion criteria

Collections of the archived paraffin blocks of surgical resection specimens of the pathology department of Seied-o-Alshohada hospital from 2015 to 2019 were examined in this study. Twenty-one cases met the inclusion criteria of this study; patients who were not simultaneously diagnosed with PTC and thyroid adenoma were excluded from the investigation. The clinicopathological characteristics of the patients are summarized in Table 1.

Table 1 Clinicopathological characteristics of patients with papillary thyroid carcinoma whose tissue blocks were sectioned in the present study
Full size table

RNA extraction and cDNA synthesis

RNA extraction from biopsy sections was performed using the RNeasy FFPE kit (Qiagen, Germany). The quality and quantity of extracted RNAs were verified using NanoDrop 2000, and cDNA synthesis was carried out using 1Ā Ī¼g of DNAase-treated total RNA samples by QuantiTect Reverse Transcription kit (Qiagen).

Real-time RT-PCR

Real-time q-PCR was conducted in triplicate, using QuantiFast SYBR Green PCR Kit (Qiagen) on StepOne Plus real-time qPCR System (Applied Biosystems, USA) following the recommended protocol of the manufacturer. The GAPDH (Glyceraldehyde-3-Phosphate Dehydrogenase) gene was selected as the reference gene, and the following primers were used to determine the expression of BMI-1: F: 5Ź¹-ATACTTCTCTGTTGCTACG-3Ź¹ and R: 5Ź¹-TGCCATCTGATTCTTACAA-3Ź¹. Relative gene expression levels were evaluated by the comparative Ī”Ī”CT method as described previously [21]. The GAPDH Forward primer, GAAGGTGAAGGTCGGAGTC, and GAPDH Reverse primer, GAAGATGGTGATGGGATTTC, were used based on Yazdani et al. studies [22].

Statistical analysis

Data analysis was done using Graphpad Prism V 8.1 for windows. One-way analysis of variance (ANOVA) was used to investigate the significance of the difference in BMI-1 expression levels between thyroid papillary carcinoma, adenoma, and adjacent healthy tissues followed by post-hoc Dunnettā€™s test. Furthermore, a two-tailed paired t-test was used to evaluate the difference in BMI-1 gene expression between adenoma and papillary carcinoma tissues. p values below 0.05 were considered significant.

Results

RNA extraction and cDNA synthesis

In this retrospective cross-sectional study, we sought to determine the expression level of the BMI-1 gene in adenoma, papillary carcinoma, and adjacent healthy tissues. Total RNA was extracted from sectioned blocks using the RNeasy FFPE Kit, and NanoDrop and agarose gel electrophoresis examined the quality and quantity of extracted RNAs.

Real-time qPCR and statistical analysis

The expression level of the BMI-1 gene in sectioned tissues was assessed using SYBR green real-time PCR assay. The results indicated that the BMI-1 gene is slightly overexpressed in both types of tissues compared to their adjacent healthy tissues (Fig.Ā 1).

Fig. 1
figure 1

Comparison of expression of BMI-1 mRNA in papillary carcinoma, adenoma, and their adjacent healthy tissues. * p-values (0.0008) below 0.05 were considered significant

Full size image

Results of the Dunnett test revealed that the BMI-1 gene was overexpressed in adenoma tissues by 1.042-fold (CI āˆ’ā€‰0.08533 to āˆ’ā€‰0.0003886, pā€‰=ā€‰0.04) and in papillary carcinoma tissues by 1.047-fold (CI āˆ’ā€‰0.09009 to āˆ’ā€‰0.005150, p: 0.02) compared with the adjacent healthy tissues.

Moreover, the results of the t-test indicated no significant difference between adenoma and papillary carcinoma in terms of the BMI-1 gene expression level (pā€‰=ā€‰0.83).

Discussion

Although conventional techniques for diagnosing thyroid carcinomas such as histological methods and FNA are considered gold standards, challenges in the differentiation of benign and malignant thyroid nodules remain unsolved [23,24,25]. Most thyroid carcinomas (differentiated papillary and follicular thyroid carcinomas) may have a promising prognosis and be treatable in case of timely diagnosis [26]. The early stratification of patients with poor prognoses would aid in selecting the most effective and appropriate therapeutic strategy [27, 28]. The lack of globally trusted biomarkers to determine aggressive types of thyroid cancer poses a significant challenge in managing and predicting patients with or at higher risk of thyroid cancer death [29].

In the present study, paraffin-embedded blocks of thyroid tissue specimens were evaluated from patients who underwent thyroid surgery from 2015 to 2019. Papillary carcinoma, adenoma, and a small part of adjacent healthy tissues were sectioned, and the expression level of BMI-1 mRNA was measured in each tissue type. Comparison of BMI-1 mRNA level in papillary carcinoma or adenoma tissues to adjacent healthy tissues revealed that BMI-1 was slightly overexpressed in both tissues (pā€‰<ā€‰0.05 for both comparisons).

Several studies have documented that BMI-1 overexpression is inversely correlated to the expression of tumor suppressor genes such as PTEN and p16 [30]. Gisler et al. [31] have shown that upregulation of BMI-1 significantly induces cancer cells proliferation. Furthermore, it has been shown that elevated BMI-1 mRNA level contributes to anti-cancer drugs resistance. Ojo et al. [32] reported that in breast cancer cell lines, BMI-1 was upregulated, and knockdown of this gene sensitizes breast cancer cells to Tamoxifen, a widely used anti-cancer drug.

Some other studies reported the association between upregulation of BMI-1 and the increment of differentiation but not proliferation. Dibenedetto et al. [33] reported that overexpression of BMI-1 mRNA in myoblast cells correlates with elevation of mitochondrial activity and increases the energetic level of cells.

Conclusion

In summary, the results of this study have shown that the BMI-1 gene was upregulated in thyroid papillary carcinoma and adenoma tissues compared to adjacent healthy tissue. Although further studies are required to demonstrate the best thyroid cancer biomarker, these findings implicated that BMI-1 can be among candidates.

Limitations

The main limitation of the study is the samples preparation. The blocks were found with adjacent normal tissues, and the patientsā€™ consent to participate in the study.Also, BMI-1 proto-oncogene protein expression evaluation as gene transcripts are not provided to reflect the tissue protein expression due to the post-translational modifications and variable stability of the related mRNA.

Availability of data and materials

Please contact corresponding author (A.E.) for data requests.

Abbreviations

BMI-1 :

B cell-specific Moloney murine leukemia virus integration site 1

FNA:

Fine needle aspiration

GAPDH :

Glyceraldehyde-3-phosphate dehydrogenase

PTC:

Papillary thyroid carcinoma

PTEN :

Phosphatase and tensin homolog

References

  1. Ernani V, Kumar M, Chen AY, Owonikoko TK. Systemic treatment and management approaches for medullary thyroid cancer. Cancer Treat Rev. 2016;50:89ā€“98.

    ArticleĀ  Google ScholarĀ 

  2. Farhood B, Raei B, Ameri H, Shirvani M, Alizadeh A, Najafi M, Mortezazadeh T. A review of incidence and mortality of colorectal, lung, liver, thyroid, and bladder cancers in Iran and compared to other countries. Contemp Oncol. 2019;23(1):7.

    Google ScholarĀ 

  3. La Vecchia C, Malvezzi M, Bosetti C, Garavello W, Bertuccio P, Levi F, Negri E. Thyroid cancer mortality and incidence: a global overview. Int J Cancer. 2015;136(9):2187ā€“95.

    ArticleĀ  Google ScholarĀ 

  4. Safavi A, Azizi F, Jafari R, Chaibakhsh S, Safavi AA. Thyroid cancer epidemiology in Iran: a time trend study. Asian Pac J Cancer Prev. 2016;17(1):407ā€“12.

    ArticleĀ  Google ScholarĀ 

  5. Sadeghi H, Rafei M, Bahrami M, Haghdoost A, Shabani Y. Attributable risk fraction of four lifestyle risk factors of thyroid cancer: a meta-analysis. J Public Health. 2018;40(2):e91ā€“8.

    ArticleĀ  Google ScholarĀ 

  6. Ardakani HAV, Moghimi M, Shayestehpour M, Doosti M, Sharifabadi SB. Survival of patients with thyroid cancer in Yazd, Iran. Asian Pac J Cancer Prev APJCP. 2017;18(8):2293.

    Google ScholarĀ 

  7. Shariati A, Moradabadi A, Chegini Z, Khoshbayan A, Didehdar M. An overview of the management of the most important invasive fungal infections in patients with blood malignancies. Infect Drug Resist. 2020;13:2329.

    ArticleĀ  CASĀ  Google ScholarĀ 

  8. Tappenden P, Carroll C, Hamilton J, Kaltenthaler E, Wong R, Wadsley J, Moss L, Balasubramanian S. Cabozantinib and vandetanib for unresectable locally advanced or metastatic medullary thyroid cancer: a systematic review and economic model. Health Technol Assess. 2019;23(8):1ā€“144.

    ArticleĀ  Google ScholarĀ 

  9. Haugen BR, Alexander EK, Bible KC, Doherty GM, Mandel SJ, Nikiforov YE, Pacini F, Randolph GW, Sawka AM, Schlumberger M. 2015 American Thyroid Association management guidelines for adult patients with thyroid nodules and differentiated thyroid cancer: the American Thyroid Association guidelines task force on thyroid nodules and differentiated thyroid cancer. Thyroid. 2016;26(1):1ā€“133.

    ArticleĀ  Google ScholarĀ 

  10. Khadra H, Mohamed H, Al-Qurayshi Z, Sholl A, Killackey M, Kandil E. Superior detection of metastatic cystic lymphadenopathy in patients with papillary thyroid cancer by utilization of thyroglobulin washout. Head Neck. 2019;41(1):225ā€“9.

    PubMedĀ  Google ScholarĀ 

  11. Moradabadi A, Farsinejad A, Khansarinejad B, Fatemi A. Development of a high resolution melting analysis assay for rapid identification of JAK2 V617F missense mutation and its validation. Exp Hematol Oncol. 2019;8:10.

    ArticleĀ  Google ScholarĀ 

  12. Moon JH, Kim YI, Lim JA, Choi HS, Cho SW, Kim KW, Park HJ, Paeng JC, Park YJ, Yi KH. Thyroglobulin in washout fluid from lymph node fine-needle aspiration biopsy in papillary thyroid cancer: large-scale validation of the cutoff value to determine malignancy and evaluation of discrepant results. J Clin Endocrinol Metab. 2013;98(3):1061ā€“8.

    ArticleĀ  CASĀ  Google ScholarĀ 

  13. McLeod DS, Zhang L, Durante C, Cooper DS. Contemporary debates in adult papillary thyroid cancer management. Endocr Rev. 2019;40(6):1481ā€“99.

    ArticleĀ  Google ScholarĀ 

  14. Afshari M, Janbabaei G, Bahrami MA, Moosazadeh M. Opium and bladder cancer: A systematic review and meta-analysis of the odds ratios for opium use and the risk of bladder cancer. PLoS ONE. 2017;12(6):e0178527.

    ArticleĀ  Google ScholarĀ 

  15. Mousavi Z, Yazdani Z, Moradabadi A, Hoseinpourkasgari F, Hassanshahi G. Role of some members of chemokine/cytokine network in the pathogenesis of thalassemia and sickle cell hemoglobinopathies: a mini review. Exp Hematol Oncol. 2019;8(1):1ā€“6.

    ArticleĀ  CASĀ  Google ScholarĀ 

  16. dos Santos HT, do Nascimento JDS, Meireles F, Scarini JF, Egal ES, Montalli VA, Fonseca FP, Mariano FV, Altemani A. Evaluation of the expression of Bmi-1 stem cell marker in sinonasal melanomas and its correlation with the expression of cell cycle proteins. Surg Exp Pathol. 2019;2(1):9.

    ArticleĀ  Google ScholarĀ 

  17. Patel N, Garikapati KR, Ramaiah MJ, Polavarapu KK, Bhadra U, Bhadra MP. miR-15a/miR-16 induces mitochondrial dependent apoptosis in breast cancer cells by suppressing oncogene BMI1. Life Sci. 2016;164:60ā€“70.

    ArticleĀ  CASĀ  Google ScholarĀ 

  18. Khairy RA, Salah M, Khalifa SE. Expression of stem cell marker Bmi1 in invasive breast cancer and correlation with estrogen receptor, progesterone receptor, HER2/neu, and ki67. Kasr Al Ainy Med J. 2016;22(3):109.

    ArticleĀ  Google ScholarĀ 

  19. Fekri-SoofiAbadi M, Fekri M, Vahidi R, Shamsi-Meymandi S, Dabiri D, Dabiri S. Ability of real-time PCR for differential diagnosis of various forms of cutaneous leishmaniasis: a comparative study with histopathology. BMC Res Notes. 2019;12(1):1ā€“5.

    ArticleĀ  CASĀ  Google ScholarĀ 

  20. Hoenerhoff MJ, Chu I, Barkan D, Liu Z, Datta S, Dimri GP, Green JE. BMI1 cooperates with H-RAS to induce an aggressive breast cancer phenotype with brain metastases. Oncogene. 2009;28(34):3022ā€“32.

    ArticleĀ  CASĀ  Google ScholarĀ 

  21. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2āˆ’ Ī”Ī”CT method. Methods. 2001;25(4):402ā€“8.

    ArticleĀ  CASĀ  Google ScholarĀ 

  22. Yazdani Z, Mousavi Z, Moradabadi A, Hassanshahi G. Significance of CXCL12/CXCR4 ligand/receptor axis in various aspects of acute myeloid leukemia. Cancer Manag Res. 2020;12:2155.

    ArticleĀ  CASĀ  Google ScholarĀ 

  23. Arcolia V, Journe F, Wattier A, Leteurtre E, Renaud F, Gabius H-J, Remmelink M, Decaestecker C, Rodriguez A, Boutry S. Galectin-1 is a diagnostic marker involved in thyroid cancer progression. Int J Oncol. 2017;51(3):760ā€“70.

    ArticleĀ  CASĀ  Google ScholarĀ 

  24. Kargaran M, et al. Effects of the aqueous extract of aloe vera on the morphological and physiological properties of E. coli. 2017;19(2).

  25. Fekrisoofiabadi M, Fekri M, Moradabadi A, Vahidi R, Khaleghi M, Ram M, Dabiri S. Evaluation of MDR1 and MRPA genes expression in different types of dry cutaneous leishmaniasis. BMC Res Notes. 2019;12(1):1ā€“4.

    ArticleĀ  CASĀ  Google ScholarĀ 

  26. Chowdhury S, Veyhl J, Jessa F, Polyakova O, Alenzi A, MacMillan C, Ralhan R, Walfish PG. Programmed death-ligand 1 overexpression is a prognostic marker for aggressive papillary thyroid cancer and its variants. Oncotarget. 2016;7(22):32318.

    ArticleĀ  Google ScholarĀ 

  27. Yuan Y, Van Allen EM, Omberg L, Wagle N, Amin-Mansour A, Sokolov A, Byers LA, Xu Y, Hess KR, Diao L. Assessing the clinical utility of cancer genomic and proteomic data across tumor types. Nat Biotechnol. 2014;32(7):644.

    ArticleĀ  CASĀ  Google ScholarĀ 

  28. Moradabadi A, Fatemi A, Noroozi-Aghideh A. Analysis of the reannealing-instead of melting-curve in the detection of JAK2 V617F mutation by HRM method. J Blood Med. 2019;10:235.

    ArticleĀ  CASĀ  Google ScholarĀ 

  29. Rajabi S, Dehghan MH, Dastmalchi R, Mashayekhi FJ, Salami S, Hedayati M. The roles and role-players in thyroid cancer angiogenesis. Endocr J. 2019;66(4):277ā€“93.

    ArticleĀ  CASĀ  Google ScholarĀ 

  30. Yokoyama Y, Arai MA, Hara Y, Ishibashi M. Identification of BMI1 promoter inhibitors from Streptomyces sp. IFM-11958. Bioorg Med Chem. 2019;27(13):2998ā€“3003.

    ArticleĀ  CASĀ  Google ScholarĀ 

  31. Gisler S, Maia ARR, Chandrasekaran G, Kopparam J, van Lohuizen M. A genome-wide enrichment screen identifies NUMA1-loss as a resistance mechanism against mitotic cell-death induced by BMI1 inhibition. PLoS ONE. 2020;15(4):e0227592.

    ArticleĀ  CASĀ  Google ScholarĀ 

  32. Ojo D, Lin X, Wu Y, Cockburn J, Bane A, Tang D. Polycomb complex protein BMI1 confers resistance to tamoxifen in estrogen receptor positive breast cancer. Cancer Lett. 2018;426:4ā€“13.

    ArticleĀ  CASĀ  Google ScholarĀ 

  33. Dibenedetto S, Niklison-Chirou M, Cabrera CP, Ellis M, Robson LG, Knopp P, Tedesco FS, Ragazzi M, Di Foggia V, Barnes MR. Enhanced energetic state and protection from oxidative stress in human myoblasts overexpressing BMI1. Stem Cell Rep. 2017;9(2):528ā€“42.

    ArticleĀ  CASĀ  Google ScholarĀ 

Download references

Acknowledgements

The present manuscript was extracted from specialty thesis of Mohadese Hajian and was funded by the school of medicine of Isfahan university of medical science.

Funding

No funding sources used in this study.

Author information

Authors and Affiliations

  1. Department of Pathology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran

    Mohadeseh HajianĀ &Ā Ardeshir Talebi

  2. Department of Cell and Molecular Biology, University of Isfahan, Isfahan, Iran

    Abolghasem Esmaeili

Authors
  1. Mohadeseh Hajian
    View author publications

    You can also search for this author in PubMedĀ Google Scholar

  2. Abolghasem Esmaeili
    View author publications

    You can also search for this author in PubMedĀ Google Scholar

  3. Ardeshir Talebi
    View author publications

    You can also search for this author in PubMedĀ Google Scholar

Contributions

AE proposed the original concept and designed the experiment and supervised all aspects of the work. MH, AE, and AT equally participated in the data acquisition and analysis. All authors contributed to writing the manuscript. AE provided critical reviews in order to promote the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Abolghasem Esmaeili.

Ethics declarations

Ethics approval and consent to participate

The experiment was approved by the Human Ethics Research Committee of Isfahan medical university under reference number IR.MUI.MED.REC.1398.05. All patients approve weitten informed consent and contribute to the study.

Consent for publication

Not applicable.

Competing interests

The authors declare no conflict of interest.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Hajian, M., Esmaeili, A. & Talebi, A. Comparative evaluation of BMI-1 proto-oncogene expression in normal tissue, adenoma and papillary carcinoma of human thyroid in pathology samples. BMC Res Notes 14, 369 (2021). https://doi.org/10.1186/s13104-021-05771-w

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13104-021-05771-w

Keywords

BMC Research Notes

ISSN: 1756-0500

Contact us