Methods
Cell culture
Human umbilical vein endothelial cells (HUVEC; C554) were purchased from Pasteur Institute (Tehran) and were seeded and cultured in DMEM-F12 (containing FBS 10% (Gibco, Thermo Fisher Scientific-US) and Pen-strep 1% (Sigma-Aldrich Co., St Louis, MO, USA)) in normal conditions (5% CO2, 37 °C).
microRNA transfection
To deliver microRNAs into HUVEC cells, Polyethylenimine (PEI, Sigma Aldrich) was used. N/P ratio equal to 20 from each PEI-miR complex (containing miR-194, miR-27a, and scramble) was made and added to the culture medium of HUVEC cells for 4 h. Then, the cells were washed by PBS and were maintained for 24 h.
Flow cytometry
To evaluate miRNA transfection, the flow cytometry technique was used. After incubating the cells with PEI containing FITC-conjugated miRNA for 4 h, they were harvested and examined by flow cytometry technique (CyFlow, Partec, Germany).
RNA extraction, cDNA synthesis, and RT-qPCR
Total RNA was extracted by GeneAll-Hybrid-R RNA purification kit (Seoul, South Korea). cDNA was synthesized using Reverse Transcriptase HyperScript™ First-strand Synthesis Kit (Seoul, South Korea). Real Time-qPCR was accomplished by TB Green Premix Ex Taq (Tli RNase H Plus) (Takara, Seoul, South Korea) using StepOne instrument (Applied Biosystems, Foster City, CA, USA). The gene expression data were normalized with beta-actin (ACTB), a house-keeping gene, to access relative gene expression. The primers of SELE (F-AGAATCAGAAACAGGTGC and R-GATGGGTGTTGCGGTTTCAG), SELP (F-ACGCTGCATTTGACCCGAG and R- CCCAAACTCAGGAAACAGGGT), JAM-B (F-GACAAGAAGTGATGCGGGGA and R- ATGATGGAACTGCTGGAGCC), and ACTIN-B (F-GCAAGCAGGAGTATGACGA and R- CAAACAAATAAAGCCATGCCAATC) were designed and checked by primer blast server.
Monocyte-endothelial adhesion
Monocytes from healthy subjects were isolated from whole blood by RosetteSep™ Human Monocyte Enrichment Cocktail kit (STEMCELL Technologies Canada Inc.). After incubating (24 h), the miRNA-transfected HUVEC cells were cocultured with isolated monocytes. Then, the molecular adhesion was assessed by CytoSelect™ Leukocyte-endothelium Adhesion Assay kit (Cell Bio labs, Inc. San Diego, CA 92126 USA).
Gene and miRNA predictions
The membrane genes were extracted from REACTOME and were improved on the STRING server (Fig. 1A). The gene data were merged with the diapedesis pathway (KEGG, hsa04670) and were presented as clusters with high-edge nodes using Cytoscape (Fig. 1B). Then, the cluster genes were enriched using GO (molecular function, molecular process) so that three genes (JAM2, SELP, and SELE) were found to be involved with leucocyte tethering on rolling function and process (Fig. 1C). In the other hand, the genes were subjects to search in miRNA databases through miRWalk server. The primary gene-miRNA networks were evaluated and trimmed on the high-frequency reports of the databases so that several miRNAs were predicted to relate to the function of genes. The high-edge miRNAs containing miR-194-5p and miR-27a-3p were selected for the study (Fig. 1D) [23, 24].
Statistical analysis
Data were analyzed using Graphpad Prism (Version 8.0.3, San Diego, CA). The significant changes in the study groups were detected by ANOVA followed with Dunn’s post hoc test. P-values < 0.05 were considered as significant levels. 2−ΔΔCt method was used to investigate the gene expression values.
Results
Flow cytometry
The cellular uptake of FITC-labeled PEI/miR complex showed that the miRNA delivery was above 98% in human umbilical vein endothelial cells (Fig. 2).
Gene expression
miR-194 and miR-27a decreased SELP gene expression level
The changes in SELP gene expression levels were significant in the cells treated with miR-194 (P = 0.037). Also, miR-27a decreased significantly the SELP gene expression levels (P = 0.0250) (Fig. 3-A).
miR-194 and miR-27a did not change SELE gene expression level
The miR-194 and miR-27a had no significant effects on the SELE gene expression levels (P = 0.9920 and P = 0.9945, respectively) (Fig. 3B).
miR-194 and miR-27a decreased JAM-B gene expression level
miR-194 and miR-27a decreased significantly the JAM-B gene expression levels in HUVEC cells (P = 0.0005 and P < 0.0001, respectively) (Fig. 3C).
miR-27a inhibited significantly monocyte-endothelial Adhesion
Data on monocyte-endothelial adhesion revealed that miR-27a inhibits significantly (P < 0.0001) monocyte adhesion to endothelial cells. miR-194, however, reduced the monocyte-endothelial adhesion but there was not significant difference as considered to miR-27a (P = 0.5243) (Fig. 3-D).
Discussion
The activated endothelial cells might overexpress adhesion molecules and enhance leukocyte adhesion following rolling, strong adhesion, crawling, and transmigration processes [7]. Many studies showed that non-coding RNAs target the adhesion molecules and other genes involved in vessel stenosis [20,21,22,23,24]. This study was focused on the effects of miRNA-related genes predicted in the monocyte diapedesis process. Some studies reported that circulating miR-27a decreases in patients with atherosclerosis and suggested to be a biomarker in diagnosis and follow-up of these patients [25]. Moreover, it is suggested that miR-27a shifts the monocyte polarization to macrophage M2 and affects plaque formation [22]. Sun Y et al. showed miR-27a suppresses FADD and prevents from HUVEC apoptosis [26]. Wang Y et al. reported miR-27a inhibits inflammation and cell adhesion in rat kidney epithelial cells by targeting TLR-4 [27]. Romay MC et al. reported miR-27a and miR-21 modulate NF-κB signaling pathway and inhibit the expression of adhesion molecules such as SELE and VCAM-1 in HAEC cells [28]. Wu XY et al. showed that miR-155 targets directly P-65 in NF-κB signaling pathway and inhibits the adhesion of monocytes to HUVECs [29]. miR-27a and b also regulate endothelial adhesion and angiogenesis by suppression of NF‐κB and SEMA6A [30,31,32]. In agreement with above reports, this study showed that the miR-27a decreases the SELP and JAM-B gene expression levels. This study also showed that miR-27a suppresses significantly the monocyte-endothelial adhesion. However, miR-27a cannot change the E-selectin expression level. It is well known that SELP and JAM-B express by endothelial cells in inflammatory events and bind to monocytes during diapedesis process [16, 18, 19, 33]. Moreover, the results showed that the miR-194 downregulates the JAM-B and SELP gene expression levels in endothelial cells. In agreement with these results, other studies on miR-194 reported that it suppresses the TGF-β/SMAD signaling pathway by targeting THBS1 resulting in the inhibition of inflammation and vasopermeability [34]. Chen R et al. showed that miR-194 inhibits CXCR4 and decreases the expression of IL-1β, IL-6, and TNF-α [35]. In this study, the monocyte-endothelial adhesion was inhibited by miR-194 but not significantly. This phenotype finding might be because more suppression of JAM-B and SELP genes by miR-27a as compared with the miR-194.
Taken together, the prediction results showed that the SELP, JAM-B, and SELE genes might effectively affect the leukocyte diapedesis process by miR-27a and miR-194. The experimental results confirmed the effects of miR-27a and miR-194 on the suppression of the SELP and JAM-B gene expression levels. However, there were no correlations between SELE and miRNAs due to the predicted low-score edges as compared with other edges. Furthermore, the data found a relation between miR-27a and the JAM-B expression levels that were not considered in prediction results.
Conclusion
The results showed that the miR-27a inhibits effectively the monocyte-endothelial adhesion by suppressing the adhesion molecules in HUVEC cells.
Limitation
The work is validated on the prediction studies. The results can improve by the focus on the molecular mechanisms between the studied miRNAs and genes and to experience their roles in interventional experiments.