Skip to main content
Download PDF

A comparison of oral bacteriome isolated from periodontal pockets of participants with or without diabetes mellitus in Uganda: a case control study

BMC Research Notes volume 17, Article number: 146 (2024) Cite this article

Abstract

Objective

Diabetes mellitus predisposes patients to increased incidence and severe forms of periodontal disease. Currently, information on the bacterial diversity of patients with diabetes mellitus and periodontitis in Uganda is scanty. This study set out to describe the bacteria associated with periodontitis in patients with diabetes mellitus in Uganda, as part of a larger study describing the association between periodontal disease and diabetes mellitus.

Results

This was a case control involving 45 samples of gingival crevicular fluid collected from participants with periodontitis, the cases being 26 participants with diabetes mellitus and controls 19 participants without diabetes mellitus. Sequencing using the 16s Oxford nanopore long read protocol was followed by a bioinformatics analysis pipeline for alpha and beta diversity indices in the two groups. Multivariate tests were done to determine the differences in the bacterial composition in the two groups. Of the 739 Operational Taxonomic Units and 500 phyla identified, 37.9% (280/739) were from participants with diabetes mellitus. Analysis of beta diversity revealed a dissimilarity between the two study groups (CAP score = 0) with a significant association noted between periodontitis and the subgingival bacteria (P = 0.001). Diabetes mellitus reduced the quantity and altered the composition of the subgingival microbiome in the study participants.

Peer Review reports

Introduction

Periodontitis is a chronic multifactorial inflammatory condition, associated with accumulation of dental plaque, that affects the supportive structures of the teeth leading to loss of attachment and subsequent tooth loss [1]. Other risk factors for periodontitis include old age, male sex, smoking, poor oral hygiene and low socioeconomic status [2,3,4]. Periodontitis has been described both as a local and systemic inflammatory condition. Apart from the local response to the oral bacteria, products of these microorganisms, notable amongst them is the Lipopolysaccharide (LPS), are potent immunomodulators and are responsible for the systemic inflammation observed in patients with severe periodontitis [5].

Therefore, the host’s immune response plays an important role in the progression of the disease as well as its association with systemic conditions [6]. Management of inflammation thus plays an important role in the control of bacteria as well as disease progression [7].

Diabetes mellitus is a group of metabolic diseases characterized by chronically elevated blood glucose levels as a result of defects in insulin secretion, insulin action or both [8]. It is classified into type 1 diabetes mellitus, type 2 diabetes mellitus, gestational diabetes mellitus and other types of unknown pathophysiology [9,10,11,12].

Diabetes mellitus is a known risk factor for periodontitis [13]. The prevalence rates of periodontitis have been reported to be twice as high in patients with diabetes mellitus compared with the non-diabetics [14, 15]. Diabetes mellitus leads to formation of endogenous activated glycation end products (AGEs) that are deposited in the different tissues including the periodontium [16, 17].

Periodontitis is a bacterial infection caused by gram negative anaerobes [12, 18]. These are also known as the red complex and include Porphyromonas gingivalis, Tanerrella forsythus and Treponema denticola [19,20,21]. Diabetes mellitus may alter the subgingival microbiome there by predisposing patients to a high prevalence and increased severity of periodontitis [22, 23].

Management of periodontal disease includes mechanical therapy, surgical treatment and use of antibiotics [24, 25]. Mechanical therapy, also known as scaling, root planning and polishing involves removal of plaque, a reservoir for bacteria that cause periodontal disease [26]. Surgical treatment is indicated in patients with exceptionally profound pockets or those where the conventional mechanical treatment has been unsuccessful. The choice of surgery depends on the severity of these but the ultimate aim is preventing progression of disease and regeneration of the lost tissues [27]. More advanced surgical techniques using dentinal derivatives have demonstrated strong regenerative properties on the periodontal tissues which may be helpful even in patients with diabetes mellitus [25]. Antibiotics when used with mechanical therapy may confer additional benefits [28]. The choice of antimicrobial agents requires an insight in the type of bacteria associated with periodontitis in the patients suffering from diabetes mellitus. Unfortunately, data on oral bacterial diversity in the Uganda diabetic population is scanty. This study set out to determine the effect of diabetes mellitus on the subgingival microbiome in adult patients suffering from periodontitis.

Methods

Study design and study setting

This was a matched case control study in the Medical Outpatients and dental departments of Kiruddu National Referral Hospital between February 2022 and January 2023.

Sample size

The study involved 45 samples [29] of gingival crevicular fluid collected from pockets of patients with a diagnosis of periodontitis using the Community Periodontal Index (CPI) values of 3 and 4 [30]. Twenty-six samples were from participants with a confirmed diagnosis of diabetes mellitus [31] while nineteen samples were from periodontitis participants with no clinical diagnosis of diabetes mellitus. The Diabetic participants were selected by systematic sampling from a larger study determining the prevalence and factors associated with periodontal disease [32]. Participants who were pregnant and those on broad spectrum antibiotics were excluded from the study.

Study procedure

Sample collection and DNA extraction

About 4 to 6 sterile paper points were inserted in the periodontal pockets for 30 s, removed and stored in 2mls cryo- vials containing 100 μl of DNA shield (Zymoresearch, CA, USA). The samples were then transported on ice to the Molecular Biology Laboratory of department of Anatomy, Makerere University College of Health Sciences. The laboratory is located within the histology laboratory on the ground and first floor of the department. DNA was extracted from these samples using the Quick-DNA Mini prep Plus Kit (Zymoresearch, CA, USA) as per the manufacturer’s instructions. It was then quantified by Nanodrop One (Themo Fisher Scientific, California, USA).

PCR amplification

The extracted DNA was then subjected to amplification in a Simpli Amp Thermocycler (Applied Biosystems, Waltham, MA, USA).

We evaluated one ribosomal marker of full length 16 S rRNA gene. The DNA containing the target bacteria was amplified to target the 16SrRNA gene using the 16–27 F (TTTCTGTTGGTGCTGATATTGCAGAGTTTGATCMTGGCTCAG) and 16 S-1492R (ACTTGCCTGTCGCTCTATCTTCGGTTACCTTGTTACGACTT) primer sets. All the primers contained the Oxford Nanopore tag which is an overhang that allows barcoding the sample during the second barcoding PCR. The mixture for the full length 16SrRNA gene (25μL total volume) contained 10ng of DNA template, 5X LongAmp Taq buffer, 0.3mM dNTPs, 0.4 μM of each primer and 0.5 units of LongAmp Taq DNA Polymerase (New England BioLabs). The PCR conditions were: denaturization of 30 s at 98oC followed by 35 cycles of 15 s at 98oC, 15 s at 51oC, 45 s at 72oC and a final step of 7 min at 72 oC and then hold at 40C. The amplicons were then run on a 2% gel stained with 1 μg/mL of ethidium bromide and viewed under U.V light in a viewer box (Vilber E-box, Vilber, Deutschland GmbH. Wielandstrasse 2, Germany).

Nanopore sequencing

Sequencing was carried out using the SQK-LSK114 sequencing kit as per manufacturer’s instructions as follows.

  • DNA repair and end-prep for 35 min.

  • Adapter ligation and clean-up for 30 min.

  • Loading the Flonge flow cell.

After PCR, the amplicons were cleaned up with Clean NGS beads (Coenecoop 75, 2741 PH Waddinxveen, Netherlands) with the ratio of 1:2 of the amplicons to the beads as per the manufacturer’s instructions. A second bead clean of 1:1 was performed using the supernatant and the beads. The supernatant was removed the DNA bound to the beads was washed twice with 800ul of freshly prepared 70% ethanol. Without disturbing the beads. The beads and DNA were re suspended in 10 μl of Nuclease free water and incubated at room temperature for 10 min. The sample containing DNA and the beads was pelleted on a magnetic rack and the supernatant containing DNA was collected. The cleaned amplicons were quantified using a Qubit™ 4 Fluorometer (Themo Fisher Scientific, City, Singapore). The purified PCR products were used for Nanopore PCR barcoding using the EXP-PBC096 PCR barcoding expansion pack (Oxford Nanopore Technologies plc, Oxford, UK) under the following conditions 370C for 20 min and 870C for 20 min. The barcoded PCR products were purified with Clean NGS beads and then pulled with equal amounts for Ligation using the SQK-LSK114-XL kit (Oxford Nanopore Technologies plc, Oxford, UK) as per the manufacturer’s instructions. The eluted DNA library was quantified using a Nano drop One (Themo Scientific, USA). The quantified DNA library consisting of 800ng was sequenced using MinION MIN-101B platform on a flongle Flow Cell FLO-FLG114 (Oxford Nanopore Technologies plc, Oxford, UK) until a coverage of seven to ten times was achieved.

Base calling, bacteria identification and cleaning

The samples were then subjected to basecalling with a quality score of 9 over a 24-hour period. Only the reads that passed and were longer than 200 bases long were retained. These were aligned against the silva database 138 using minimap2 to identify the bacteria. A series of inhouse R, version 4.2.2, scripts were used to clean the data and create the Phyloseq objects which was used in the analysis of the data. Analysis involved recording the total number of OTUs followed by a series of comparisons using the Phyloseq [33] and Vegan [34] packages in R. Using a Phyloseq and Vegan packages, we tested for differences in alpha and phylogenetic diversity between the two groups. Analysis of Variance was used to determine the factors associated with the differences in microbial composition of the two groups.

Descriptive characteristics

A total of 45 samples of gingival crevicular fluid were collected from 45 study participants. Twenty-six samples were from participants with diabetes mellitus and the nineteen samples were from participants without diabetes mellitus. The sociodemographic characteristics of the participants are summarized in Table 1.

Table 1 Sociodemographic characteristics of the study participants
Full size table

Alpha diversity of the study participants

Out of the 739 Operational Taxonomic Units (OTUs), the participants with diabetes mellitus had 280 OTUs while those without diabetes mellitus had 459 OTUs. There was a marked difference in the taxa abundance between the two study groups (Fig. 1). The fifty most common families of bacteria are shown in Fig. 2.

Fig. 1
figure 1

Alpha diversity measure plots with diabetic and non-diabetic groups in gingival crevicular fluid samples of participants with periodontitis

Full size image
Fig. 2
figure 2

A figure illustrating the 30 most abundant and significant taxa in the two study groups

Full size image

Beta diversity of the study participants

There was a significant difference in microbiome between the participants with diabetes mellitus and those without diabetes mellitus. Participants with diabetes mellitus had a predorminancy of Enterobacteriaceae, Thiotrichaceae, Sporomucaceae and streptomycetaceae while those without diabetes mellitus had a predorminancy of Fusobacteriaceae, Veillonellaceae, Streptococcaceae and Prevotellaceae (Fig. 2). A constrained analysis of principle coordinates revealed a great dissimilarity between the two study groups (Fig. 3).

Fig. 3
figure 3

A graphic representation of constrained analysis of principle coordinates (CAP) illustrating the dissimilarity between the two study groups

Full size image

Constrained analysis of principal coordinated of the factors associated with beta diversity

There was a significant association between periodontitis and beta diversity between the participants with diabetes mellitus and those without diabetes mellitus with p = 0.001 (Table 2).

Table 2 A table illustrating constrained analysis of principal coordinates (CAP) to test for significancy of selected explanatory variables
Full size table

Discussion

This study set out to describe the bacteria associated with periodontitis in adults with diabetes mellitus in Uganda. It is the first of its kind in Uganda. This study identified over 500 families of bacteria in the subgingival fluid samples collected from the study participants. Generally, participants with diabetes mellitus had a marked decrease in the quantity of the subgingival microbiome compared to those without diabetes mellitus. Furthermore, there was a significant difference in the subgingival microbiome of participants with participants fewer OTUs than those without diabetes mellitus. The observed differences were significantly associated with periodontitis.

Our study reports a difference in alpha diversity in the study participants with participants suffering from diabetes mellitus contributing only 38% of the total OTUs (Fig. 1). Our findings are in line with Saeb et al. [35] who reported a reduced alpha diversity in participants with diabetes mellitus compared to those without diabetes mellitus. This study thus contradicts an earlier study by Taylor et al. [36] that refutes claims of diabetes mellitus affecting the subgingival microbiome citing lack of sufficient scientific evidence. A more recent study by Santos et al. [37] characterizing oral microbiome in patients with diabetes mellitus reports no difference in alpha and beta diversity between the non-diabetic and patients with diabetes mellitus. It should however be noted that that particular study used saliva samples while the current study used gingival crevicular fluid samples.

This study reports a difference in the oral microbiome composition between the two study groups which was significantly associated with the diabetic status.

Diabetes mellitus is characterized by chronically elevated blood sugar levels in blood. Gupta et al. [38] has reported a positive correlation between the patient’s glycemic state and the salivary glucose levels. Fermentation of these sugars releases acids hence favoring the survival of acidogenic and aciduric bacteria. Indeed, Cena et al. [39] has reported a higher abundancy of acid associated bacteria notably Lactobacillus, Tanerrella and Veillonela in diabetic patients compared to the normoglyceamic participants. Results from the current study show a lower abundancy of Veillonella in patients with diabetes mellitus compared to those without diabetes mellitus. Other acidogenic bacteria like Streptococcus and Prevotella were also reduced. This is further supported by the regression model which revealed no association between glycemic state and the beta diversity. However, one lactate forming bacteria, Sporomusaceae [40] was exclusively found in participants with diabetes mellitus.

The severity of periodontitis, clinically determined by the pocket depth may have an effect in the diversity of the microbiome. Deeper pockets are likely to favor survival of anaerobes than aerobes. Cai et al. [41] in their study comparing the oral microbiome in patients with periodontitis and those without periodontitis noted a significant increase of Spirochetes, Bacteroides and Fusobacteria. These bacteria are all obligate anaerobes. Results from the present study report a high prevalence of Moraxella and Listeria in participants with diabetes mellitus. These are aerobes that are more likely to survive in shallow pockets. There is a likelihood that participants with diabetes mellitus had mild forms of periodontitis compared to those who were normal. This is likely due to the fact that most of the participants without diabetes mellitus were selected from patients with periodontal disease attending the dental clinics while the cases were patients who had come to hospital for diabetic care and not periodontal treatment.

The role of medications in patients with diabetes mellitus may play a role in the variations observed in the oral microbiome. A part from the hypoglycemics, patients with diabetes mellitus are more like to be affected by a number of medical conditions that may necessitate the need for medications [42]. Metformin, a common oral hypoglycemic has been reported to exhibit an antibacterial effect when taken with other antibiotics [43]. Kizito et al. [44] in their study on antibacterial use in patients admitted on medical wards documented a wider prescription of broad-spectrum antibiotics. The greater use of these antibiotics may partly be responsible for the reduced microbial diversity observed in patients with diabetes mellitus.

Limitations

The study did not consider antimicrobial resistance, which may undue influence the inference on use of antibiotics in the management of periodontitis in the studied population.

The study did not measure the sugar concentrations in saliva, which would provide information on the effect of salivary sugar levels on the oral microbiome.

Though the type of diabetic medication was recorded, the study participants were not classified into type 1 or type 2 DM. This may have affected the results obtained from this study.

This study was carried out in a low resource setting and may this not be representative of the larger diabetic population.

Conclusion

The diabetic status significantly reduced the subgingival microbiome in patients with periodontitis. There is a need for further studies to strengthen the correlation of the oral microbiome isolated from periodontal pockets in subjects with or without diabetes in Uganda, highlighting the importance of managing periodontal health in diabetic patients and the appropriate measures to be taken to improve overall health outcomes and reduce the risk of health complications.

Data availability

The data is available at https://www.ncbi.nlm.nih.gov/sra/PRJNA1087153.

Abbreviations

CAPs:

Constrained Analysis of Principal Coordinates

DM:

Diabetes Mellitus

DNA:

Deoxyribose Nucleic Acid

MAKCHS-SBSREC:

Makerere University College of Health Sciences School of Biomedical Sciences Research and Ethics Committee

OTUs:

Operational Taxonomic Units

PCR:

Polymerase Chain Reaction

rRNA:

Ribosomal Ribose Nucleic Acid

References

  1. Papapanou PN, Sanz M, Buduneli N, Dietrich T, Feres M, Fine DH, Flemmig TF, Garcia R, Giannobile WV, Graziani F, et al. Periodontitis: consensus report of workgroup 2 of the 2017 world workshop on the classification of periodontal and peri-implant diseases and conditions. J Periodontol. 2018;89(S1):S173–82.

    Article  PubMed  Google Scholar 

  2. Nazir MA. Prevalence of periodontal disease, its association with systemic diseases and prevention. Int J Health Sci (Qassim). 2017;11(2):72–80.

    PubMed  Google Scholar 

  3. Gayatri RW, Tama TD, Alma LR, Yun LW, Savira L, Kuroidah A. Behavioral risk factors and periodontal disease in Malang, Indonesia. Gac Sanit. 2021;35:S438–40.

    Article  PubMed  Google Scholar 

  4. Salih Y, Nasr AM, Ahmed ABA, Sharif ME, Adam I. Prevalence of and risk factors for periodontal disease among pregnant women in an antenatal care clinic in Khartoum, Sudan. BMC Res Notes. 2020;13(1):147.

    Article  PubMed  PubMed Central  Google Scholar 

  5. Wadia R. Periodontitis and systemic inflammation. Br Dent J. 2022;233(6):494–494.

    PubMed  Google Scholar 

  6. Heitz-Mayfield LJ. Disease progression: identification of high-risk groups and individuals for periodontitis. J Clin Periodontol. 2005;32(Suppl 6):196–209.

    Article  PubMed  Google Scholar 

  7. Hajishengallis G. The inflammophilic character of the periodontitis-associated microbiota. Mol Oral Microbiol. 2014;29(6):248–57.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Kharroubi AT, Darwish HM. Diabetes mellitus: the epidemic of the century. World J Diabetes. 2015;6(6):850–67.

    Article  PubMed  PubMed Central  Google Scholar 

  9. Powers AC. Type 1 diabetes mellitus: much progress, many opportunities. J Clin Investig. 2021;131(8).

  10. Westman EC. Type 2 diabetes mellitus: a pathophysiologic perspective. Front Nutr. 2021;8.

  11. Plows JF, Stanley JL, Baker PN, Reynolds CM, Vickers MH. The pathophysiology of gestational diabetes mellitus. Int J Mol Sci. 2018;19(11).

  12. The bidirectional relationship between periodontal disease and diabetes mellitus—a review. Diagnostics. 2023;13(4):681.

  13. Siebert T. Impact of risk factor diabetes mellitus on patients with periodontitis. Qeios.

  14. Zheng M, Wang C, Ali A, Shih YA, Xie Q, Guo C. Prevalence of periodontitis in people clinically diagnosed with diabetes mellitus: a meta-analysis of epidemiologic studies. Acta Diabetol. 2021;58(10):1307–27.

    Article  PubMed  Google Scholar 

  15. Saini R, Saini S, Sugandha R. Periodontal disease: the sixth complication of diabetes. J Family Community Med. 2011;18(1):31.

    Article  PubMed  PubMed Central  Google Scholar 

  16. Davis KE, Prasad C, Vijayagopal P, Juma S, Imrhan V. Advanced glycation end products, inflammation, and chronic metabolic diseases: links in a chain? Crit Rev Food Sci Nutr. 2016;56(6):989–98.

    Article  CAS  PubMed  Google Scholar 

  17. Chen CY, Zhang JQ, Li L, Guo MM, He YF, Dong YM, Meng H, Yi F. Advanced glycation end products in the skin: molecular mechanisms, methods of measurement, and inhibitory pathways. Front Med. 2022;9:837222.

    Article  Google Scholar 

  18. Silva DNA, Casarin M, Monajemzadeh S, Bezerra BB, Lux R, Pirih FQ. The microbiome in periodontitis and diabetes. Front oral Health. 2022;3:859209.

    Article  PubMed  PubMed Central  Google Scholar 

  19. Mohanty R, Asopa SJ, Joseph MD, Singh B, Rajguru JP, Saidath K, Sharma U. Red complex: polymicrobial conglomerate in oral flora: a review. J Family Med Prim care. 2019;8(11):3480–6.

    Article  PubMed  PubMed Central  Google Scholar 

  20. Suzuki N, Yoneda M, Hirofuji T. Mixed red-complex bacterial infection in periodontitis. Int J Dent. 2013;2013:587279.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Tadjoedin FM, Masulili SLC, Rizal MI, Kusdhany LS, Turana Y, Ismail RI, Bachtiar BM. The red and orange complex subgingival microbiome of cognitive impairment and cognitively normal elderly with periodontitis. Geriatrics. 2022;7(1):12.

    Article  PubMed  PubMed Central  Google Scholar 

  22. Matsha TE, Prince Y, Davids S, Chikte U, Erasmus RT, Kengne AP, Davison GM. Oral microbiome signatures in diabetes mellitus and periodontal disease. J Dent Res. 2020;99(6):658–65.

    Article  CAS  PubMed  Google Scholar 

  23. Omori M, Kato-Kogoe N, Sakaguchi S, Kamiya K, Fukui N, Gu Y-H, Nakamura S, Nakano T, Hoshiga M, Imagawa A, et al. Characterization of salivary microbiota in elderly patients with type 2 diabetes mellitus: a matched case–control study. Clin Oral Invest. 2021;26:493–504.

    Article  Google Scholar 

  24. Tariq M, Iqbal Z, Ali J, Baboota S, Talegaonkar S, Ahmad Z, Sahni JK. Treatment modalities and evaluation models for periodontitis. Int J Pharm Invest. 2012;2(3):106–22.

    Article  Google Scholar 

  25. Bianchi S, Mancini L, Torge D, Cristiano L, Mattei A, Varvara G, Macchiarelli G, Marchetti E, Bernardi S. Bio-morphological reaction of human periodontal ligament fibroblasts to different types of dentinal derivates: in vitro study. Int J Mol Sci. 2021;22(16).

  26. Lamont T, Worthington HV, Clarkson JE, Beirne PV. Routine scale and Polish for periodontal health in adults. Cochrane Database Syst Rev. 2018;12(12):Cd004625.

    PubMed  Google Scholar 

  27. Ziada H, Irwin C, Mullally B, Byrne P, Allen E. Periodontics: 4. Surgical Management of Gingival and Periodontal diseases. Dent Update. 2007;34:390–2.

    Article  PubMed  Google Scholar 

  28. Chatzopoulos GS, Koidou VP, Tsalikis L. Local drug delivery in the treatment of furcation defects in periodontitis: a systematic review. Clin Oral Invest. 2023;27(3):955–70.

    Article  Google Scholar 

  29. Qin H, Li G, Xu X, Zhang C, Zhong W, Xu S, Yin Y, Song J. The role of oral microbiome in periodontitis under diabetes mellitus. J Oral Microbiol. 2022;14(1):2078031.

    Article  PubMed  PubMed Central  Google Scholar 

  30. Singh A, Sinha RK, Richa S, Kumar R, Kishor A, Kumar A. Assessment of periodontal status and treatment needs among beedi factory workers. J Pharm Bioallied Sci. 2021;13(Suppl 1):S237–40.

    Article  PubMed  PubMed Central  Google Scholar 

  31. Association AD. Standards of medical care in diabetes—2021 abridged for primary care providers. Clin Diabetes. 2021;39(1):14–43.

    Article  Google Scholar 

  32. Kiryowa HM, Munabi IG, Buwembo W, Rwenyonyi CM, Kaddumukasa M, Sabakaki EM. Prevalence and factors associated with periodontal disease in patients with diabetes mellitus attending Kiruddu National Referral Hospital, Uganda. Pan Afr Med J. 2022;43:202.

    Article  PubMed  PubMed Central  Google Scholar 

  33. Liu T, Zhou C, Wang H, Zhao H, Wang T. phyloMDA: an R package for phylogeny-aware microbiome data analysis. BMC Bioinformatics. 2022;23(1):213.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. McMurdie PJ, Holmes S. Phyloseq: a bioconductor package for handling and analysis of high-throughput phylogenetic sequence data. Pacific Symposium on Biocomputing Pacific Symposium on Biocomputing. 2012:235–246.

  35. Saeb ATM, Al-Rubeaan KA, Aldosary K, Udaya Raja GK, Mani B, Abouelhoda M, Tayeb HT. Relative reduction of biological and phylogenetic diversity of the oral microbiota of diabetes and pre-diabetes patients. Microb Pathog. 2019;128:215–29.

    Article  PubMed  Google Scholar 

  36. Taylor JJ, Preshaw PM, Lalla E. A review of the evidence for pathogenic mechanisms that may link periodontitis and diabetes. J Periodontol. 2013;84(4 Suppl):S113–134.

    PubMed  Google Scholar 

  37. Almeida-Santos A, Martins-Mendes D, Gayà-Vidal M, Pérez-Pardal L, Beja-Pereira A. Characterization of the oral microbiome of medicated type-2 diabetes patients. Front Microbiol. 2021;12:610370.

    Article  PubMed  PubMed Central  Google Scholar 

  38. Gupta V, Kaur A. Salivary glucose levels in diabetes mellitus patients: a case-control study. J oral Maxillofacial Pathology: JOMFP. 2020;24(1):187.

    Article  PubMed  PubMed Central  Google Scholar 

  39. Cena JA, Reis LG, de Lima AKA, Vieira Lima CP, Stefani CM, Dame-Teixeira N. Enrichment of acid-associated microbiota in the saliva of type 2 diabetes mellitus adults: a systematic review. Pathogens. 2023;12(3):404.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Aoyagi T, Kashiwabara Y, Kurasawa H, Amachi S, Nakajima N, Hori T, Yamamura S. Draft genome sequence of a novel lactate-fermenting bacterial strain of the family sporomusaceae within the class negativicutes. Microbiol Resource Announcements. 2019;8(10).

  41. Cai Z, Lin S, Hu S, Zhao L. Structure and function of oral microbial community in periodontitis based on integrated data. Front Cell Infect Microbiol. 2021;11:663756.

    Article  PubMed  PubMed Central  Google Scholar 

  42. Akash MSH, Rehman K, Fiayyaz F, Sabir S, Khurshid M. Diabetes-associated infections: development of antimicrobial resistance and possible treatment strategies. Arch Microbiol. 2020;202(5):953–65.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Masadeh MM, Alzoubi KH, Masadeh MM, Aburashed ZO. Metformin as a potential adjuvant antimicrobial agent against multidrug resistant bacteria. Clin Pharmacology: Adv Appl. 2021;13:83–90.

    Google Scholar 

  44. Kizito M, Lalitha R, Kajumbula H, Ssenyonga R, Muyanja D, Byakika-Kibwika P. Antibiotic prevalence study and factors influencing prescription of WHO watch category antibiotic ceftriaxone in a tertiary care private not for profit hospital in Uganda. Antibiot (Basel Switzerland). 2021;10(10).

  45. WMA: The World Medical Association. (2013). Declaration of Helsinki 2013 [Accessed 19/02/2014]; Available from: URL: http://www.wma.net/e/ethicsunit/helsinki.htm. In.; 2013.

Download references

Acknowledgements

We send our appreciation to the National Institute Of Dental & Craniofacial Research of the National Institutes of Health under Award Number R56DE032217 for providing us with equipment and reagents for conducting this study. We would like to extend our special thanks to the research assistants, Ms. Nalwanga Sylvia, and Ms. Balikuddembe Getrude, the management of Kiruddu hospital and the study participants.

Funding

Research reported in this publication was supported by the Fogarty International Centre of the National Institutes of Health, U.S. Department of State’s Office of the U.S. Global AIDS Coordinator and Health Diplomacy (S/GAC), and President’s Emergency Plan for AIDS Relief (PEPFAR) under Award Number 1R25TW011213. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Author information

Authors and Affiliations

  1. School of Biomedical Sciences, Makerere University College of Health Sciences, P.O. Box 7072, Kampala, Uganda

    Haruna Muhmood Kiryowa, William Buwembo, Ian Guyton Munabi & Erisa Sabakaki Mwaka

  2. School of Dentistry, Makerere University College of Health Sciences, P.O. Box 7072, Kampala, Uganda

    Charles Mugisha Rwenyonyi

  3. School of Medicine, Makerere University College of Health Sciences, P.O. Box 7072, Kampala, Uganda

    Mark Kaddumukasa & Sarah Kiguli

Authors
  1. Haruna Muhmood Kiryowa
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. William Buwembo
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Ian Guyton Munabi
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Erisa Sabakaki Mwaka
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Charles Mugisha Rwenyonyi
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Mark Kaddumukasa
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Sarah Kiguli
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

HMK designed the study, collected the data, carried out the laboratory analysis, entered the data, analyzed the data, interpreted the data and drafted the manuscript. WB and IGM participated in the laboratory analysis and provided additional interpretation of the results. ESM, CMR, MK and SK provided additional interpretation of the results. All authors proofread the manuscript before its submission.

Corresponding author

Correspondence to Haruna Muhmood Kiryowa.

Ethics declarations

Ethics approval and consent to participate

The study protocol was approved by Makerere University School of Biomedical Sciences Research and Ethics Committee (MAK SBS-REC: SBS-726) and registered by Uganda National Council of Science and Technology (UNCST: HS106ES). Informed consent was obtained from participants and confidentiality was maintained in accordance with Helsinki Declaration [45].

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Kiryowa, H.M., Buwembo, W., Munabi, I.G. et al. A comparison of oral bacteriome isolated from periodontal pockets of participants with or without diabetes mellitus in Uganda: a case control study. BMC Res Notes 17, 146 (2024). https://doi.org/10.1186/s13104-024-06804-w

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13104-024-06804-w

Keywords

BMC Research Notes

ISSN: 1756-0500

Contact us