Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Research Notes

Open Access

Development of microsatellite markers for Hyacinth macaw (Anodorhynchus hyacinthinus) and their cross-amplification in other parrot species

  • Helder E. da Silva1,
  • Flavia T. Presti1,
  • Adriane P. Wasko1 and
  • Danillo Pinhal1Email author
BMC Research Notes20158:736

https://doi.org/10.1186/s13104-015-1749-9

Received: 29 April 2015

Accepted: 25 November 2015

Published: 1 December 2015

Abstract

Background

Hyacinth macaw Anodorhynchus hyacinthinus is the largest parrot of the world and is considered vulnerable to extinction due to its habitat loss and illegal trade associated to the international pet market demand. Genetic studies on this species are still incipient to generate a consistent characterization of the population dynamics and to develop appropriate conservation strategies. In this sense, microsatellite markers may support the detection of a population genetic structure for this bird species. However, at this time, none Hyacinth macaw species-specific primers for microsatellite loci have been so far established. This study aimed to develop and characterize polymorphic microsatellite markers for A. hyacinthinus and to check for their cross-amplification in other parrot species.

Findings

Sequences containing repeated dinucleotide motifs were prospected and optimized from a genomic library that was enriched for microsatellites using magnetic beads. The analyses of 43–57 samples from wild individuals of three distinct Brazilian subpopulations led to the characterization of five polymorphic microsatellite loci. Allele richness per locus ranged from two to 12. Three loci exhibited observed heterozygosity values higher than 50 %, but the overall average value among all loci was close to 45 %. In addition, successful primer cross-amplification was verified in seven other investigated species of Neotropical parrots.

Conclusions

The newly developed markers have shown to be potentially useful for in situ and ex situ population studies to support future conservation actions of Hyacinth macaw and other parrots.

Keywords

MicrosatellitesGenetic diversityCross-species amplificationConservationParrots

Findings

Hyacinth macaw Anodorhynchus hyacinthinus (Latham, 1790; Psittaciformes, Psittacidae) is the largest parrot of the world and has great importance in conservation biology due to its flagship species status [1, 2]. In Brazil, the species is mainly distributed in three non-continuous regions that correspond to different biomes, exhibiting dissimilar faunal and floral compositions. In these areas, Hyacinth macaw has different preference for food items and nesting sites [3, 4]. Moreover, their populations are sensitive to the continuous habitat loss and have also been directly affected by the illegal trade, which led this species to be considered as vulnerable to extinction [5]. Genetic studies have gained prominence to aid in the conservation of a wide-range endangered vertebrates [69], including bird species [6]. Among the genetic markers, microsatellite loci have shown to be useful in variable contexts, notably to estimate the influence of genetic components in population studies [10], to trace the geographic origin of unknown individuals [11] or to determine the kinship of siblings [12], among other applications. Currently, there is a very limited source of microsatellite loci characterized in Neotropical parrots, despite of the species richness of this group [13]. Available studies on Hyacinth macaw have used nonspecific microsatellite markers to assess the genetic variability of this species [14], their population genetic structure [15, 16] and to identify the probable geographic origin of a rescued individual from captivity [16]. Despite one pair of primers that was developed for A. hyacinthinus (Davis S, unpublished data), all these studies used heterologous primers characterized for other parrot species such as Ara ararauna [17, 18], Amazona guildingii [19, 20], and Psittacus erithacus [21]. However, these other birds do not represent sister taxa of the genus Anodorhynchus and are not closely interrelated [22, 23]. In this sense, the use of heterologous microsatellite primers generally leads to a decrease in the polymorphism level as the phylogenetic distance among species increases [2426]. In fact, for Hyacinth macaw, the number of alleles and observed heterozygosity for all analysed heterologous loci were considerably lower when compared to those species from which the primers were originally described [16]. In addition, a lower genetic variability has been observed in threatened parrots when compared to other non-threatened species [14]. So far, there are no species-specific primers for microsatellite loci available for Hyacinth macaw described in literature. Thus, considering the vulnerable status of this species, a proper assessment of the genetic background of extant populations requires the analysis of a considerable number of loci. Consequently, the development of microsatellite specific primers for A. hyacinthinus could enlarge the rol of available molecular tools for the accurate assessment of its genetic diversity and population structure. Thereby, in this study we report the isolation and characterization of microsatellite loci for Hyacinth macaw and their cross-amplification in other species of Neotropical parrots.

Total genomic DNA from 57 individuals of A. hyacinthinus from distinct Brazilian regions (Table 1) was isolated following the extraction protocol using proteinase K and phenol–chloroform [27]. A DNA sample of one animal was used on a digestion assay and fragments between 700 and 1200 bp were selected by digestion with the restriction enzyme AfaI (Invitrogen) and further ligated to adapters with known sequences (Rsa21 and Rsa25). Then these fragments were enriched throughout hybridization to probes containing dinucleotide repeats (GT and CT) chemically linked to biotin and selected using magnetic beads covered with streptavidin. Subsequently, the recovered fragments were inserted into a cloning vector pGEM-T Easy (Promega), and electroporation was used to transform competent cells of Escherichia coli (XL1-Blue). Then, plasmid extraction was performed using the alkaline lysis method [28], and T7 and SP6 primers were used for sequencing the library inserts with an ABIPrism 3500xL Genetic Analyzer (Applied Biosystems). The protocol used for microsatellite enrichment technique was described in Billotte et al. [29] with some modifications. Generated nucleotide sequences were screened for microsatellites regions in the program SSRIT [30]. Primer3 plus [31] and OligoAnalyzer 3.1 (Integrated DNA Technologies) softwares were used for the design of the species-specific primers and to verify the occurrence of hairpins, self-dimers, and heterodimers. PCR conditions were as follows: initial denaturation at 95 °C for 10 min, followed by 35 cycles at 95 °C for 1 min, 45–65 °C for 40 s (nine annealing temperatures were applied: 45, 53, 55, 57, 59, 60, 61, 63, and 65 °C), 72 °C for 40 s, and a final extension at 72 °C for 10 min. Each PCR contained 20–50 ng of DNA, 0.1 μL of TaqDNA polymerase (5 U/μL, Invitrogen), 1 μL of each primer (10 mM), 0.4 μL of MgCl2 (25 mM), 1.2 μL of PCR buffer (10×), 1 μL of dNTPs (2.5 mM), and autoclaved Milli-Q water to complete 12 μL. Approximately 3 μL of the products were electrophoresed through 1.5 % agarose gels to verify amplification success.
Table 1

Sample data used for the microsatellite loci characterization in Hyacinth macaw

Subpopulation

Location

NT

NL

Field collection year

Pará (PA)

Canaã dos Carajás

2

1–2

2013

1

1

2009

9

5–9

2008

5

0–3

2007

Parque Zoobotânico (Parauapebas)

6

6

2013

1

0–1

2007

Rio Itacaiúnas (FLONA Itacaiúnas)

1

1

2013

Fundação Zoobotânica (Marabá)

1

0–1

2007

Redenção

1

1

1997

Parque Zoobotânico (Belém)

2

0–2

Rio Iriri (Altamira)

1

0–1

Serra dos Carajás (Serra Norte)

1

0–1

Capitão Poço

1

0–1

1

0–1

 

33

20–27

 

Northest (NE)

Piauía

4

1–4

1999

Tocantinsa

11

3–10

 

15

5–14

 

Pantanal (PN)

Rio Negro, MS

1

0–1

2001–2002

Nhecolândia, MS

3

1–3

2000–2002

Abobral, MS

3

2–3

2000

Barão do Melgaço, MT

5

2–5

2009

 

5

4–5

2002–2004

 

17

7–17

 

Unknown

Fundação Lymington

3

0–3

2013

Total

 

68

43–57

 

NT total number of samples used considering all loci separately, NL variation in the number of samples used considering each locus independently

aUnknown exact locality

–: Unknown data

For the genetic analyses, we collected approximately 0.1 mL of peripheral blood from the brachial veins of the lower wing of chicks found in natural nests, using disposable syringes and needles. The nests were accessed by an alpinism technique adapted to trees. Subsequently, the blood samples were transferred into microtubes containing approximately 0.5 mL of absolute ethanol and kept at air temperature. In addition, several research partners provided samples that were collected in previous field campaigns (details in Table 1). This work was approved by the federal government authoritative (IBAMA; permission Number: 36590-1). Microsatellite markers that yielded a clear amplification band on agarose gels were then tested for polymorphism level using 43–57 samples of A. hyacinthinus belonging to three potentially sub-populations of this species (Table 1). The polymorphism level was determined by a genotyping method throughout PCR amplification of the DNA samples with a sequence-specific forward primer composed by a M13 (−21) tail with distinct fluorescent dye labels (HEX or FAM, Applied Biosystems) [32], following a previously established protocol [33]. Fragments genotyping was performed in ABIPrism 3500xL or ABIPrism 3130xL Genetic Analyzers (Applied Biosystems) in order to detect the alleles size. Each reaction contained 0.1 μL of TaqDNA polymerase (5 U/μL, Invitrogen), 0.1 μL of the forward primer with a M13 tail (5′CACGACGTTGTAAAACGAC-3′) (10 μM) [33], 0.3 μL of the reverse primer (10 μM), 0.2 μL of fluorescent dye label (10 mM), 0.4 μL of MgCl2 (25 mM), 1 μL of dNTPs (4 mM), 1.2 μL of PCR buffer (10×), 20–50 ng of DNA, and autoclaved Milli-Q water to complete 12 μL. PCR conditions were as follows: initial denaturation at 95 °C for 10 min, followed by 35 cycles at 95 °C for 1 min, 57–60 °C for 40 s (as detailed in Table 2), and 72 °C for 40 s, followed by 10 M13 tail cycles at 95 °C for 1 min, 55 °C for 40 s, 72 °C for 40 s, and a final extension step at 72 °C for 10 min. Approximately 2 μL of the products were electrophoresed through 1.5 % agarose gels to evaluate amplification success and to estimate their concentration. An aliquot of 1.0 μL of each amplified product was mixed with 0.2 μL of a molecular marker GeneScan ™ ROX ™-500 STANDARD (2 fmol, Applied Biosystem) and Hi-Di™ formamide (Applied Biosystems) to complete 10 μL of reaction. The mixture was analyzed in automatic sequencer ABIPrism 3500 (Applied Biosystems). The peaks and the sizes of the fragments for each allele were obtained by GeneMarker v2.6.3. The Genepop 4.2 program [34] was used to check the number of alleles per locus, linkage disequilibrium between loci, expected heterozygosity (He), observed heterozygosity (Ho), inbreeding coefficient (Fis) and Hardy–Weinberg equilibrium. The software Cervus was used to estimate the PIC (polymorphic information content) of each locus and the Micro-checker program [35] was used to assess the presence of null alleles, genotyping errors, and allele dropout. Additionally, we tested the transferability of the described primer sets in other seven Neotropical parrot species (Amazona guildingii, A. ochrocephala, Ara severus, A. macao, A. ararauna, A. chloropterus, and Anodorhynchus leari). For this purpose, PCR conditions were as follows: an initial denaturation step at 95 °C for 10 min, followed by 10 cycles at 95 °C for 1 min, 60 °C touchdown decreasing 0.5 °C at every cycle, and 72 °C for 40 s, followed by 25 cycles at 95 °C for 1 min, 55 °C for 40 s, 72 °C for 40 s and a final extension at 72 °C for 10 min. Each PCR contained 20–50 ng of DNA, 0.2 μL of TaqDNA polymerase (5 U/μL, Invitrogen), 1 μL of each primer (10 mM), 0.4 μL of MgCl2 (25 mM), 1.2 μL of PCR buffer (10×), 1 μL of dNTPs (2.5 mM), and autoclaved Milli-Q water to complete 12 μL. An aliquot of 3 μL of each product was electrophoresed in 1.5 % agarose gels to evaluate amplification success.
Table 2

Characterization of species-specific primers developed for Hyacinth macaw

Locus

Primers sequences (5′–3′)

Repeat motif

Size range

T °C

N

n

Ho

He

Fis

PIC

AnH6

F AAAGGCAGTTCAGGTGTTGG

R ACACACACGCACATACTCCA

(GT)n(AT)n(GT)n

234–236

60–55 °C (td)

44

2

0.500

0.502

0.003

0.373

AnH10

F CCTATACCCAGCTCCCAACA

R AGCCTTCAGTGGCTCATTGT

(AC)×9

166–172

57 °C

57

3

0.175

0.193

0.092

0.179

AnH17

F TTCCCATTGGATATCTTGTCAG

R ATTGGCAATGGCCTAAACAC

(CA)×16

184–192

59 °C

49

5

0.531

0.669

0.217

0.605

AnH23

F TGTGGCATCTGTAAAGAAAGAGG

R GCCTGGGGAGTGATTGTTTA

(AC)×9

222

57 °C

18

1a

AnH33

F GCCTGTGCCAGATGGTAAAT

R GCCCTAAAAATGCTTTCCAA

(TG)×12

177–179

60–55 °C (td)

51

2

0.275

0.363

0.237

0.295

AnH34

F GACAGACACATCCGCTTCAA

R AACACACATCTTCATATGCAACC

(TG)×24

172–210

60 °C

43

12

0.721

0.818

0.119

0.786

    

Mean

 

4.8

0.440

0.509

0.134

0.448

Microsatellite loci, sequence of primers, repeat motifs, fragment size, annealing temperature (T °C), number of used samples (N), number of alleles (n), observed heterozygosity (Ho), expected heterozygosity (He), inbreeding coefficient (Fis) and PIC (polymorphic information content)

td touchdown decreasing 0.5 °C per cycle

aMonomorphic loci

From a library composed by a total of 96 bacterial colonies, 52 clones (54.17 %) were recovered and sequenced. The majority of the generated sequences, however, were not suitable for primers design or possessed a low number of repeat motifs and therefore had to be discarded. From this filtering step, only six clones could be used for the primers design (11.53 %).

As outcome, with the exception of the AnH23 locus that was found to be monomorphic, five isolated microsatellite loci were polymorphic in A. hyacinthinus (Table 2). The number of alleles per locus varied from two (AnH6 and AnH33) to 12 (AnH34), the observed heterozygosity ranged from 0.175 (AnH10) to 0.721 (AnH34), with an average of 0.440 for all loci, and the expected heterozygosity per locus ranged from 0.193 (AnH10) to 0.818 (AnH34) with an average of 0.509 between all loci (Table 2). All analyzed polymorphic loci have shown no evidence of linkage disequilibrium (p > 0.05) and no locus was found in Hardy–Weinberg disequilibrium (p > 0.01). In the analysis carried out in the Micro-checker program [35], the presence of null alleles was not detected. In addition, among the five polymorphic loci, two (AnH6 and AnH33) were considered reasonably informative (PIC between 0.25 and 0.5) and two (AnH17 and AnH34) were highly informative (PIC > 0.5) (Table 2) [36]. Furthermore, the designed primers for Hyacinth macaw generated amplification products for other seven species of Neotropical parrots. The primer sets AnH6, AnH33, and AnH17 led to amplification results for two, three, and five species, respectively, whereas both AnH10 and AnH34 primer sets were effective for six species (Table 3). Although the AnH23 locus was monomorphic in A. hyachintinus, primers for this microsatellite also generated amplification products for all the other tested parrots and their polymorphism should be further investigated. Curiously, primers for the AnH6 locus did not lead to amplification results in A. leari that is the phylogenetically closest species to Hyacinth macaw, probably due to specific mutations in the primers annealing regions. The described primers in this work have proven to be functional and can serve as important tools to determine the variability and the genetic structure of populations of Hyacinth macaw and other Neotropical parrots and may assist in in situ and ex situ conservation plans.
Table 3

Cross amplification of Anadorhynchys hyacinthinus microsatellite loci in other seven species of Neotropical parrots

Species

Locus

AnH6

AnH10

AnH17

AnH23

AnH33

AnH34

Amazona guildingii

+

+

+

Amazona ochrocephala

+

Ara severus

+

+

+

+

+

Ara macao

+

+

+

+

Ara ararauna

+

+

+

+

+

Ara chloropterus

+

+

+

+

+

+

Anodorhynchus leari

+

+

+

+

+

+ Amplified successfully

− Not amplified

Availability of supporting data

The microsatellites data supporting the results of this article are available in GenBank at NCBI (http://www.ncbi.nlm.nih.gov/genbank/). Accession Numbers KP860340 to KP860345.

Declarations

Authors’ contributions

HS performed the construction of microsatellite-enriched genomic library, optimized PCR reactions, microsatellite genotyping, and data analysis and also drafted the manuscript. FP helped in genotyping, in the discussion of the results and revised drafts of the manuscript. AW contributed with materials, equipment and revised the manuscript. DP coordinated the study, helped in the discussion of the results and critically edited and revised all drafts of the manuscript. All authors read and approved the final manuscript.

Acknowledgements

This work had a financial support of VALE S.A., São Paulo Research Foundation (FAPESP), Coordenadoria de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). The Instituto Chico Mendes de Proteção à Biodiversidade and Instituto Arara Azul supported field campaings and data collection. The authors thanks Laboratório de Genética e Evolução Animal from University of São Paulo (USP) by samples donation and Grace Ferreira Da Silva, Luiz Pereira Rodrigues (Mogno Meio Ambiente), Dezivaldo Ribeiro Nascimento, Fernando, Patrick Karassawa, Ludmila Conrado, Talita Aleixo Roberto de Almeida, Mayla Barbirato, Frederico Drumond Martins and Humberto de Souza Baldan for helping in field work.

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Genetics, Institute of Biosciences, São Paulo State University (UNESP)

References

  1. Sick H. Ornitologia Brasileira. 3rd ed. Rio de Janeiro: Editora Nova Fronteira; 1997.Google Scholar
  2. Guedes NMR. Management and conservation of the large macaws in the wild. Ornitol Neotrop. 2004;15:279–83.Google Scholar
  3. Guedes NMR. Reproductive biology of Hyacinth Macaw (Anodorhynchus hyacinthinus) in the Pantanal-MS, Brazil. Dissertation. Piracicaba: University of São Paulo; 1993.Google Scholar
  4. Presti FT, Oliveira-Marques AR, Silva GF, Miyaki CY, Guedes NM. Notas sobre alguns aspectos da biologia da arara-azul (Anodorhynchus hyacinthinus) (Psittaciformes: Psittacidae) na região do Carajás, Pará. Atual Ornitol. 2009;151:4–7.Google Scholar
  5. BirdLife International. Species factsheet: Anodorhynchus hyacinthinus. 2015. http://www.birdlife.org. Accessed 18 March 2015.
  6. Martinez-Cruz B, Godoy JA, Negro JJ. Population genetics after fragmentation: the case of the endangered Spanish imperial eagle (Aquila adalberti). Mol Ecol. 2004;13:2243–55.View ArticlePubMedGoogle Scholar
  7. Mockford SW, Herman TB, Snyder M, Wright JM. Conservation genetics of Blanding’s turtle and its application in the identification of evolutionarily significant units. Conserv Genet. 2007;8(1):209–19.View ArticleGoogle Scholar
  8. Chapman DD, Pinhal D, Shivji MS. Tracking the fin trade: genetic stock identification in western Atlantic scalloped hammerhead sharks Sphyrna lewini. ESR. 2009;9:221–8.View ArticleGoogle Scholar
  9. Haag T, Santos AS, Sana DA, Morato RG, Cullen L Jr, Crawshaw PG Jr, De Angelo C, Di Bitetti MS, Salzano FM, Eizirik E. The effect of habitat fragmentation on the genetic structure of a top predator: loss of diversity and high differentiation among remnant populations of Atlantic Forest jaguars (Panthera onca). Mol Ecol. 2010;19(22):4906–21.View ArticlePubMedGoogle Scholar
  10. Oliveira EJ, Padua JG, Zucchi MI, Vencovsky R, Vieira MLC. Origin, evolution and genome distribution of microsatellites. Genet Mol Biol. 2006;29(2):294–307.View ArticleGoogle Scholar
  11. Manel S, Berthier P, Luikart G. Detecting wildlife poaching: identifying the origin of individuals with bayesian assignment tests and multilocus genotypes. Conserv Biol. 2002;16(6):650–9.View ArticleGoogle Scholar
  12. Berger-Wolf TY, Sheikh SI, DasGupta B, Ashley MV, Caballero IC, Chaovalitwongse W, Putrevu SL. Reconstructing sibling relationships in wild populations. Bioinformatics. 2007;23(13):i49–56.View ArticlePubMedGoogle Scholar
  13. Presti FT, Wasko A. A review of microsatellite markers and their application on genetic diversity studies in parrots. Open J Genet. 2014;4:69–77.View ArticleGoogle Scholar
  14. Presti FT, Oliveira-Marques AR, Caparroz R, Biondo C, Miyaki CY. Comparative analysis of microsatellite variability in five macaw species (Psittaciformes, Psittacidae): application for conservation. Genet Mol Biol. 2011;34:348–52.PubMed CentralView ArticlePubMedGoogle Scholar
  15. Faria PJ, Guedes NMR, Yamashita C, Martuscelli P, Miyaki CY. Genetic variation and population structure of the endangered Hyacinth Macaw (Anodorhynchus hyacinthinus): implications for conservation. Biodivers Conserv. 2008;17:765–79.View ArticleGoogle Scholar
  16. Presti FT, Guedes NMR, Antas PTZ, Miyaki CY. Population genetic structure in hyacinth macaws (Anodorhynchus hyacinthinus) and identification of the probable origin of confiscated individuals. J Hered. 2015;106(S1):491–502.View ArticlePubMedGoogle Scholar
  17. Caparroz R, Miyaki CY, Baker AJ. Characterization of microsatellite loci in the Blue and gold Macaw, Ara ararauna (Psittaciformes: Aves). Mol Ecol Notes. 2003;10:1046–8.Google Scholar
  18. Gebhardt KJ, Waits LP. Cross-species amplification and optimization of microsatellite markers for use in six neotropical parrots. Mol Ecol Res. 2008;4:835–9.View ArticleGoogle Scholar
  19. Russello MA, Calcagnotto D, DeSalle R, Amato G. Characterization of microsatellite loci in the endangered St. Vicent Parrot, Amazona guildingii. Mol Ecol Notes. 2001;1:13–5.View ArticleGoogle Scholar
  20. Russello MA, Lin K, Amato G, Caccone A. Additional microsatellite loci for endangered St. Vicent Parrot, Amazona guildingii. Conserv Genet. 2005;6(4):643–5.View ArticleGoogle Scholar
  21. Taylor TD, Parkin DT. Characterization of 12 microsatellite primer pairs for the African grey parrot, Psittacus erithacus and their conservation across the Psittaciformes. Mol Ecol Notes. 2007;7:163–7.View ArticleGoogle Scholar
  22. Tavares ES, Baker AJ, Pereira SL, Miyaki CY. Phylogenetic relationships and historical biogeography of neotropical parrots (Psittaciformes: Psittacidae: Arini) inferred from mitochondrial and nuclear DNA sequences. Syst Biol. 2006;55:454–70.View ArticlePubMedGoogle Scholar
  23. Tokita M, Kiyoshi T, Armstrong KN. Evolution of craniofacial novelty in parrots through developmental modularity and heterochromy. Evol Dev. 2007;9:590–601.View ArticlePubMedGoogle Scholar
  24. Galbusera P, van Dongen S, Matthysen E. Cross species amplification of microsatellite primers in passerine birds. Conserv Genet. 2000;1:163–8.View ArticleGoogle Scholar
  25. Zane L, Bargelloni L, Patarnello T. Strategies for microsatellite isolation: a review. Mol Ecol. 2002;11:1–16.View ArticlePubMedGoogle Scholar
  26. Primmer CR, Painter JN, Koskinen MT, Palo JU, Merila J. Factors affecting avian cross-species microsatellite amplification. J Avian Biol. 2005;36:348–60.View ArticleGoogle Scholar
  27. Bruford MW, Hanotte O, Brookfield JFY, Burke T. Single locus and multilocus DNA fingerprinting. In: Hoelzel CAR, editor. Molecular genetic analyses of populations: a pratical approach. New York: Oxford University Press; 1992. p. 225–69.Google Scholar
  28. Birboim HC, Doly J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids. 1979;7(6):1513–23.View ArticleGoogle Scholar
  29. Billotte N, Lagoda PJL, Risterucci AM, Baurens FC. Microsatellite-enriched libraries: applied methodology for the development of SSR markers in tropical crops. Fruits. 1999;54:277–88.Google Scholar
  30. Temnykh S, Lukashova A, Cartinhour S, DeClerck G, Lipovich L, McCouch S. Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): frequency, length variation, transposon associations, and genetic marker potential. Genome Res. 2001;11(8):1441–52.PubMed CentralView ArticlePubMedGoogle Scholar
  31. Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Leunissen JAM. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007;35(suppl 2):w71–4.PubMed CentralView ArticlePubMedGoogle Scholar
  32. Schuelke M. An economic method for the fluorescent labeling of PCR fragments. Nat Biotechnol. 2000;18(2):233–4.View ArticlePubMedGoogle Scholar
  33. Boutin-Ganache I, Raposo M, Raymond M, Descepper CF. M13-tailed primers improve the readability and usability of microsatellite analyses performed with two different allele sizing methods. Biotechniques. 2001;31:1–3.Google Scholar
  34. Raymond M, Rousset F. GENEPOP (version 1.2): population genetic software for exact tests and ecumenicism. J Hered. 1995;86:248–9.Google Scholar
  35. Brookfield JFY. A simple new method for estimating null allele frequency from heterozygote deficiency. Mol Ecol. 1996;5(3):453–5.View ArticlePubMedGoogle Scholar
  36. Botstein D, White RL, Skolnick M, Davis RW. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet. 1980;32:314–31.PubMed CentralPubMedGoogle Scholar

Copyright

© da Silva et al. 2015

Advertisement