Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Research Notes

Open Access

Development and characterization of polymorphic microsatellite loci for spiny-footed lizards, Acanthodactylus scutellatus group (Reptilia, Lacertidae) from arid regions

  • Sara Cristina Lopes1, 2,
  • Guillermo Velo-Antón1,
  • Paulo Pereira1,
  • Susana Lopes1,
  • Raquel Godinho1, 2,
  • Pierre-André Crochet3 and
  • José Carlos Brito1, 2Email author
BMC Research Notes20158:794

https://doi.org/10.1186/s13104-015-1779-3

Received: 1 July 2015

Accepted: 30 November 2015

Published: 17 December 2015

Abstract

Background

Spiny-footed lizards constitute a diverse but scarcely studied genus. Microsatellite markers would help increasing the knowledge about species boundaries, patterns of genetic diversity and structure, and gene flow dynamics. We developed a set of 22 polymorphic microsatellite loci for cross-species amplification in three taxa belonging to the Acanthodactylus scutellatus species group, A. aureus, A. dumerili/A. senegalensis and A. longipes, and tested the same markers in two other members of the group, A. scutellatus and A. taghitensis.

Results

Amplifications in A. aureus, A. longipes and A. dumerili/A. senegalensis were successful, with markers exhibiting a number of alleles varying between 1 and 19. Expected and observed heterozygosity ranged, respectively, between 0.046–0.893 and 0.048–1.000. Moreover, 17 and 16 loci were successfully amplified in A. scutellatus and A. taghitensis, respectively.

Conclusion

These markers are provided as reliable genetic tools to use in future evolutionary, behavioural and conservation studies involving species from the A. scutellatus group.

Keywords

Cross-species amplificationNuclear markersPopulation geneticsSahara-Sahel

Background

Spiny-footed lizards, or fringe-toed lizards (genus Acanthodactylus), form a clade of small ground-dwelling lizards occurring mostly in arid regions [1, 2]. The genus is the most specious of the Lacertidae family and is widely distributed, occurring from the Iberian Peninsula, south of the Mediterranean Basin, across the Sahara-Sahel, Arabian Peninsula, and as far east as India [1, 2]. Being often abundant and occupying different types of open, flat habitats, these lizards are important elements of the vertebrate communities of deserts and arid ecosystems in North Africa and Arabia. Despite their diversity, knowledge about most of the species is still scarce and their taxonomy is partly unresolved [14]. Most authors agree on splitting Acanthodactylus into several species groups or complexes [1, 4]. The A. scutellatus species group shows one of most complex taxonomies [2, 58]. It includes six species according to the last global revision (A. aureus, A. dumerili, A. longipes, A. scutellatus, A. senegalensis and A. taghitensis) [3]. However, urgent systematic revision based on molecular data is needed given that: (1) eastern populations previously attributed to A. longipes are now considered a new species (A. aegyptius, [7]); and (2) species boundaries in A. scutellatus, A. longipes, A. dumerili and A. senegalensis as currently defined remain uncertain (own unpublished data, SC Lopes, Velo-Antón, Crochet, Brito). The species group has multiple forms occurring in sympatry in Mauritania—A. aureus, A. dumerili, A. senegalensis, and A. longipes [9]. In this contact zone, morphologically intermediate individuals were previously observed [3] and molecular studies are needed to distinguish whether high morphological diversity or hybridization explain these intermediate morphotypes. In addition, assessment of gene flow in such areas of sympatry would be critical for a better understanding of the species boundaries. Microsatellite markers have been extremely useful, and affordable, for addressing numerous topics in conservation and evolutionary biology, allowing, e.g., gene flow and population structure assessments, demographic inferences and genetic diversity estimation [1012]. Yet, no microsatellite markers are available for the Acanthodactylus genus.

Here we describe a set of 22 polymorphic microsatellite loci (tri- and tetranucleotides) characterized in four species included in the A. scutellatus species group (A. aureus, A. longipes and A. dumerili/A. senegalensis). Considering the uncertain species boundaries for A. dumerili and A. senegalensis, we chose to refer to them as A. dumerili/A. senegalensis in the following sections. We further tested cross-amplification of these markers in two other members of the species group, A. scutellatus and A. taghitensis.

Methods

A genomic library was constructed from 12 specimens of A. aureus, collected across the species’ distribution. A tissue sample was collected from the tail tip by following ethical guidelines for use of live reptiles (http://www.aaalac.org/accreditation/Guidelines_for_Use_of_Live_Amphibians_and_Reptiles.pdf). All specimens were released on site after sample collection. Fieldwork was developed with permission from the Ministére Délégué auprès du Premier Ministre Chargé de l’Environnement, Nouakchott (Permit: 460/MDE/PNBA) and from the Haut Commissariat aux Eaux et Forêts et à la Lutte Contre la Désertification, Rabat (Permits 256-2012 and 20-2013). Analyses were done at a CITES registered laboratory: 13PT0065/S. Field collection and handling practices were approved by the Committee of Animal Experimentation of the University of Porto (Portugal) under the Directive 2010/63/EU of the European Parliament.

Genomic DNA extractions were performed from tissue samples using EasySpin Kit (Qiagen), following an adapted protocol for tissue samples (with minor adjustments to centrifugation and incubation conditions) and then pooled in equimolar concentrations. The changes to the extraction protocol were as follows: after adding the AB solution, we centrifuged at 3700 rpm for 4 min (instead of 4000 rpm for 2 min). After adding the Wash solution, we centrifuged at 3700 rpm for 6 min (instead of 8000 rpm for 1 min). After repeating the Wash solution step and discarding flow-through, we centrifuged at 3700 rpm for 10 min (instead of 14,000 rpm for 5 min). After adding the Elution Buffer, we incubated at 55° for 15 min (instead of 50° for 10 min). Last centrifugation was at 3700 rpm (instead of 14,000 rpm). Microsatellite isolation was developed through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries [13]. This process was developed by GenoScreen (http://www.pasteur-lille.fr/fr/recherche/plateformes/tordeux_plat.html) and included sequence data quality control, assembly and analyses, and primer design. Initially, 50 loci were selected from the library and tested for amplification using seven samples of A. aureus, A. dumerili/A. senegalensis, and A. longipes. Thirty loci amplified reliably, producing fragments of the expected size. Twenty-two were polymorphic (Table 1), and amplified with differential success in the following target species: 21 in A. aureus, 18 in A. longipes and 15 in A. dumerili/A. senegalensis. These 22 loci were therefore used for genotyping 38 samples of A. aureus, 35 of A. longipes, and 43 of A. dumerili/A. senegalensis, collected along coastal Morocco and Mauritania (Table 2; Fig. 1). Markers were multiplexed in four reactions, using M13-primer genotyping protocol with four different dye-labelled tails, and forward primer concentration of 1/10 of dye-labelled reverse primer [14] (Table 1). The transferability of the primers was tested by cross-amplification of five specimens of A. scutellatus (from Morocco, Tunisia, Libya, Algeria and Egypt) and one specimen of A. taghitensis (Mauritania). PCR amplifications were conducted using the Multiplex PCR Kit (QIAGEN) following manufacturer’s instructions in a final 10 μl volume, always in the presence of a negative control. Touchdown PCR conditions started with an initial denaturation step of 15 min at 95 °C; first round (nine cycles) of 30 s at 95 °C, 90 s for annealing (decreasing 0.5 °C per cycle) at 58–54 °C (Multiplexes 1, 2 and 3) or 55–51 °C (Multiplex 4), and 30 s at 72 °C; second round (31 cycles) of 30 s at 95 °C, 1 min at 54 °C (Multiplexes 1, 2 and 3), or 51 °C (Multiplex 4), 30 s at 72 °C, and a final extension of 30 min at 60 °C. Amplification was performed in Biorad T100 Thermal Cyclers, and the PCR products were later separated by capillary electrophoresis on an automatic sequencer ABI3130xl Genetic Analyzer (AB Applied Biosystems). Fragments were scored against the GeneScan-500 LIZ Size Standard using the GENEMAPPER 4.1 (Applied Biosystems) and manually checked twice. Potential evidences of null alleles, allelic dropouts and stuttering were assessed using MICRO-CHECKER v2.2.3 [15] at each locus, for each population. Tests for Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were assessed in GENEPOP online version (http://wbiomed.curtin.edu.au/genepop/); with subsequent Bonferroni correction in both cases. Observed and expected heterozygosity were computed using GenAlEx v6.501 [16]. For some populations, samples were obtained from different localities. Consequently, analyses were based on groups of samples that are not necessarily panmitic populations, which probably accounts for deviations from Hardy–Weinberg equilibrium.
Table 1

Global characterization of the 22 microsatellite loci characterized in Acanthodactylus aureus, A. dumerili/A. senegalensis and A. longipes

Locus

GenBank assess no.

Repeat

Primer sequence (5′–3′)

Multiplex

TD

Dye

Ac1

KU295182

(ATAC)8

F: CTGTGGTATATCCCCTGCCA

R: GGTGGCTTCTCCACAGCTATT

1

58°/54°

FAM

Ac4

KU295183

(TTC)21

F: ACAGCTCTGCAGTAATTCCATTT

R: CCGATGCAGTGTTTCGTAGG

3

58°/54°

VIC

Ac5

KU295184

(AAC)15

F: GTTGCTTCAACTGCTCCTCC

R: AGTGTCCTGTGCACAACCAG

1

58°/54º

VIC

Ac6

KU295185

(TTG)10

F: GTAGCCCAGTCAGATGGGTG

R: CCTCCAACATTCCAGTCCAG

4

55°/51°

NED

Ac8

KU295186

(TTG)11

F: GACATCTGAAGGCAGCCCTA

R: GGTTGTAGCCTGGAGCAGAA

1

58°/54°

NED

Ac9

KU295187

(CAA)15

F: TCATACAGGGATGTTTCAGGG

R: GCAGGAGGAAGGAAGCTTTT

1

58°/54°

PET

Ac13

KU295188

(AAC)14

F: TCCATGGGGTCACAAAGAGT

R: TCTCCAGCACTTATCTGATGC

2

58°/54°

FAM

Ac14

KU295189

(CAA)10

F: TTAAGTGGCAATGTGTTGCAT

R: TCCCACATGGTGGGTTACTT

2

58°/54°

VIC

Ac16

KU295190

(AGG)10

F: AGTCAATTTATTCAAATGATCTTCCA

R: TCATCCAAGAAAATCTGCTGC

2

58°/54°

VIC

Ac19

KU295191

(AAC)14

F: TCATTTCACTTCAAACCTGTGG

R: ACTGATGTTGGGTTTGGAGC

2

58°/54°

PET

Ac20

KU295192

(GTT)11

F: ATGCATAAGTACGAAAAGGGGA

R: TCTACAGAGAAAGAGAAATAACAACAA

2

58°/54°

PET

Ac23

KU295193

(CAT)8

F: GCGAACATGCACAAGGTTT

R: ACCCTGCTTGGTTCTCATTG

1

58°/54°

FAM

Ac28

KU295194

(ACAT)8

F: TGTCCGAAATAGGATGGAGC

R: GGAAAGCCAATGCCTCTACA

4

55°/51°

PET

Ac31

KU295195

(GTT)10

F: GAAGGGTTACAACTGCCTGG

R: CAGTGCTTCAGCAACAGGAG

4

55°/51°

FAM

Ac32

KU295196

(TTC)15

F: TAGTCCGTAAACTTGTGGGTCA

R: TTCTCAGACAACAGACACCCA

3

58°/54°

FAM

Ac33

KU295197

(TGT)16

F: GGCACTGAAATATGTGGTTTTG

R: TGACATGCTTCGGTGAAGTC

3

58°/54°

FAM

Ac36

KU295198

(TGT)9

F: GTCACGTTGATTGCATTGCT

R: GCCAACTGGGAAACCTAGC

3

58°/54°

VIC

Ac43

KU295199

(CAA)13

F: AGCTTTTGTACGTTCCTTTGC

R: CCAGAGAAACACATATGCAAGC

4

55°/51°

FAM

Ac44

KU295200

(GGA)11

F: TCCTTAAGAAAGGTACTTAATGCCA

R: TCTTTACGTAGTCCCTTTGTGG

4

55°/51°

VIC

Ac45

KU295201

(CAA)10

F: AGGCAATGGAAGACAGGGA

R: GCCTACAGTTTGTGCATAGGG

4

55°/51°

VIC

Ac47

KU295202

(ACA)11

F: CTTGCCTCTTCGCTTTCTGT

R: TCCGGACAGCATTCCTCTAC

4

55°/51°

NED

Ac49

KU295203

(AAC)11

F: CAAAGAAAATTGTTGGAGGGG

R: GTAAAACATCGGAAGGCAGC

4

55°/51°

PET

TD touchdown temperatures

Table 2

Data on sampling localities for each species

Code

Species

Latitude

Longitude

Local

Country

6477

A. aureus

20.9444

−16.5494

Kerekchet et Teintâne, extreme N

Mauritania

A366

A. aureus

21.2182

−16.8432

Nouâdhibou, 40 km S of

Mauritania

A367

A. aureus

21.2182

−16.8432

Nouâdhibou, 40 km S of

Mauritania

A368

A. aureus

21.2182

−16.8432

Nouâdhibou, 40 km S of

Mauritania

A369

A. aureus

21.2182

−16.8432

Nouâdhibou, 40 km S of

Mauritania

A358

A. aureus

21.0978

−16.6998

Nouâdhibou, 70 km S of

Mauritania

A359

A. aureus

21.0978

−16.6998

Nouâdhibou, 70 km S of

Mauritania

A360

A. aureus

21.0978

−16.6998

Nouâdhibou, 70 km S of

Mauritania

A361

A. aureus

21.0978

−16.6998

Nouâdhibou, 70 km S of

Mauritania

A362

A. aureus

21.0978

−16.6998

Nouâdhibou, 70 km S of

Mauritania

A363

A. aureus

21.0978

−16.6998

Nouâdhibou, 70 km S of

Mauritania

6449

A. aureus

20.8233

−16.5882

PNBA: Kerekchet et Teintâne, central

Mauritania

6458

A. aureus

20.8023

−16.5718

PNBA: Kerekchet et Teintâne, central

Mauritania

5171

A. aureus

20.7190

−16.6195

PNBA: Kerekchet et Teintâne, central 2

Mauritania

5172

A. aureus

20.7190

−16.6195

PNBA: Kerekchet et Teintâne, central 2

Mauritania

5173

A. aureus

20.7251

−16.6291

PNBA: Kerekchet et Teintâne, W side 1

Mauritania

5176

A. aureus

20.7620

−16.6183

PNBA: Kerekchet et Teintâne, W side 3

Mauritania

6443

A. aureus

20.7764

−16.6287

PNBA: Kerekchet et Teintâne, Western face

Mauritania

6446

A. aureus

20.8115

−16.6158

PNBA: Kerekchet et Teintâne, Western face

Mauritania

6448

A. aureus

20.8115

−16.6158

PNBA: Kerekchet et Teintâne, Western face

Mauritania

6435

A. aureus

20.7938

−16.5462

PNBA: Sebkhet Dbâdeb et Teintâne, W margin

Mauritania

A437

A. aureus

28.8731

−10.7027

Aoreora, 15 km E of (Plage Blanche)

Morocco

A438

A. aureus

28.8731

−10.7027

Aoreora, 15 km E of (Plage Blanche)

Morocco

A439

A. aureus

28.8731

−10.7027

Aoreora, 15 km E of (Plage Blanche)

Morocco

A440

A. aureus

28.8731

−10.7027

Aoreora, 15 km E of (Plage Blanche)

Morocco

A441

A. aureus

28.8731

−10.7027

Aoreora, 15 km E of (Plage Blanche)

Morocco

A442

A. aureus

28.8731

−10.7027

Aoreora, 15 km E of (Plage Blanche)

Morocco

A443

A. aureus

28.8731

−10.7027

Aoreora, 15 km E of (Plage Blanche)

Morocco

A435

A. aureus

28.7447

−10.7438

Aoreora, 25 km S of

Morocco

A436

A. aureus

28.7447

−10.7438

Aoreora, 25 km S of

Morocco

A556

A. aureus

29.8511

−9.7706

Bou Soun

Morocco

10,625

A. aureus

28.5177

−11.2970

Douira, N of

Morocco

10,638

A. aureus

28.3701

−11.4387

Douira, S of

Morocco

10,634

A. aureus

28.1544

−11.9117

Laareig

Morocco

10,636

A. aureus

27.9291

−12.2945

Leirane

Morocco

9048

A. aureus

28.9662

−10.6000

Plage Blanche

Morocco

10,635

A. aureus

28.0875

−12.0814

Sidi Akhfennir

Morocco

10,624

A. aureus

28.5479

−10.9583

Tafnidilt

Morocco

6470

A. dum./sen.

20.9172

−16.5418

Kerekchet et Teintâne, extreme N

Mauritania

6473

A. dum./sen.

20.9204

−16.5415

Kerekchet et Teintâne, extreme N

Mauritania

6474

A. dum./sen.

20.9204

−16.5415

Kerekchet et Teintâne, extreme N

Mauritania

3618

A. dum./sen.

20.0500

−16.0582

PNBA: Adeim el Marrâr

Mauritania

5111

A. dum./sen.

19.9733

−16.1874

PNBA: Agreigrât, 1 km E of

Mauritania

6384

A. dum./sen.

20.1010

−16.1655

PNBA: Aguilâl

Mauritania

5126

A. dum./sen.

20.1287

−16.1581

PNBA: Aguilâl 1

Mauritania

5135

A. dum./sen.

20.1497

−16.1420

PNBA: Aguilâl 4

Mauritania

5120

A. dum./sen.

20.1498

−16.1719

PNBA: Aguilâl, 1 km W of

Mauritania

5158

A. dum./sen.

20.7802

−16.3944

PNBA: Amgheououas es Sâhli

Mauritania

5160

A. dum./sen.

20.7843

−16.4027

PNBA: Amgheououas es Sâhli

Mauritania

5162

A. dum./sen.

20.8007

−16.4227

PNBA: Amgheououas es Sâhli, 3 km NW of

Mauritania

6390

A. dum./sen.

20.1808

−16.1474

PNBA: Dlo’ Matai

Mauritania

6391

A. dum./sen.

20.1808

−16.1474

PNBA: Dlo’ Matai

Mauritania

6394

A. dum./sen.

20.2330

−16.1247

PNBA: Dlo’ Matai

Mauritania

2750

A. dum./sen.

20.2789

−16.1003

PNBA: Dló Matai

Mauritania

3622

A. dum./sen.

20.0934

−16.0613

PNBA: Grâret Zra

Mauritania

2768

A. dum./sen.

20.8070

−16.5701

PNBA: Kerekchet et Teintâne

Mauritania

2769

A. dum./sen.

20.8070

−16.5701

PNBA: Kerekchet et Teintâne

Mauritania

6450

A. dum./sen.

20.8233

−16.5882

PNBA: Kerekchet et Teintâne, central

Mauritania

6453

A. dum./sen.

20.8233

−16.5882

PNBA: Kerekchet et Teintâne, central

Mauritania

6456

A. dum./sen.

20.8023

−16.5718

PNBA: Kerekchet et Teintâne, central

Mauritania

6457

A. dum./sen.

20.8023

−16.5718

PNBA: Kerekchet et Teintâne, central

Mauritania

6460

A. dum./sen.

20.8283

−16.5672

PNBA: Kerekchet et Teintâne, central

Mauritania

6461

A. dum./sen.

20.8283

−16.5672

PNBA: Kerekchet et Teintâne, central

Mauritania

6462

A. dum./sen.

20.8283

−16.5672

PNBA: Kerekchet et Teintâne, central

Mauritania

6463

A. dum./sen.

20.8283

−16.5672

PNBA: Kerekchet et Teintâne, central

Mauritania

6468

A. dum./sen.

20.8294

−16.5518

PNBA: Kerekchet et Teintâne, central

Mauritania

6469

A. dum./sen.

20.8294

−16.5518

PNBA: Kerekchet et Teintâne, central

Mauritania

5181

A. dum./sen.

20.7831

−16.5865

PNBA: Kerekchet et Teintâne, central 3

Mauritania

6445

A. dum./sen.

20.8115

−16.6158

PNBA: Kerekchet et Teintâne, Western face

Mauritania

2763

A. dum./sen.

20.8060

−16.4561

PNBA: N of Baie d’Arguin

Mauritania

2743

A. dum./sen.

20.0964

−16.1798

PNBA: NE of El Mounâne

Mauritania

6377

A. dum./sen.

20.1233

−16.1266

PNBA: Oued Nouafferd

Mauritania

5139

A. dum./sen.

20.1574

−16.1037

PNBA: Oued Nouafferd 3

Mauritania

6375

A. dum./sen.

20.0845

−16.1313

PNBA: Oued Nouafferd, 2 km S of

Mauritania

6376

A. dum./sen.

20.0845

−16.1313

PNBA: Oued Nouafferd, 2 km S of

Mauritania

3615

A. dum./sen.

20.0928

−16.1059

PNBA: Râs Tafarît, 16 km E of

Mauritania

6433

A. dum./sen.

20.8173

−16.4858

PNBA: Sebkhet Dbâdeb et Teintâne, 2 km E of

Mauritania

6431

A. dum./sen.

20.7791

−16.4602

PNBA: Sebkhet Dbâdeb et Teintâne, 4 km E of

Mauritania

6426

A. dum./sen.

20.7395

−16.4150

PNBA: Sebkhet Dbâdeb et Teintâne, 8 km SE of

Mauritania

6363

A. dum./sen.

19.9808

−16.1016

PNBA: Taguîlâlet Jreik, 2 km W of

Mauritania

6364

A. dum./sen.

19.9808

−16.1016

PNBA: Taguîlâlet Jreik, 2 km W of

Mauritania

2745

A. longipes

20.0699

−16.0896

PNBA: 5 km E of El Mounâne

Mauritania

6319

A. longipes

19.6589

−16.2639

PNBA: Ackenjeîl

Mauritania

6320

A. longipes

19.6589

−16.2639

PNBA: Ackenjeîl

Mauritania

6369

A. longipes

20.0567

−16.0993

PNBA: Adeim el Marrâr, 4 km W of

Mauritania

6383

A. longipes

20.1010

−16.1655

PNBA: Aguilâl

Mauritania

6386

A. longipes

20.1010

−16.1655

PNBA: Aguilâl

Mauritania

5119

A. longipes

20.1498

−16.1719

PNBA: Aguilâl, 1 km W of

Mauritania

A344

A. longipes

20.5080

−16.2380

PNBA: Bir el Gareb, 15 km S of

Mauritania

A345

A. longipes

20.5080

−16.2380

PNBA: Bir el Gareb, 15 km S of

Mauritania

A346

A. longipes

20.5080

−16.2380

PNBA: Bir el Gareb, 15 km S of

Mauritania

A347

A. longipes

20.5080

−16.2380

PNBA: Bir el Gareb, 15 km S of

Mauritania

6339

A. longipes

19.8079

−16.1479

PNBA: Elb en Nouçç, extreme S

Mauritania

6340

A. longipes

19.8079

−16.1479

PNBA: Elb en Nouçç, extreme S

Mauritania

6348

A. longipes

19.7819

−16.1880

PNBA: Grâret Agoueifa

Mauritania

6349

A. longipes

19.7819

−16.1880

PNBA: Grâret Agoueifa

Mauritania

6414

A. longipes

20.5046

−16.3389

PNBA: Îmgoûtene, 5 km NE of

Mauritania

3607

A. longipes

19.8232

−16.2100

PNBA: Iouîk, 16 km SE of

Mauritania

6451

A. longipes

20.8233

−16.5882

PNBA: Kerekchet et Teintâne, central

Mauritania

6452

A. longipes

20.8233

−16.5882

PNBA: Kerekchet et Teintâne, central

Mauritania

5168

A. longipes

20.7328

−16.6021

PNBA: Kerekchet et Teintâne, central 1

Mauritania

5163

A. longipes

20.7538

−16.5820

PNBA: Kerekchet et Teintâne, E side 1

Mauritania

5164

A. longipes

20.7538

−16.5820

PNBA: Kerekchet et Teintâne, E side 1

Mauritania

5167

A. longipes

20.7309

−16.5902

PNBA: Kerekchet et Teintâne, E side 2

Mauritania

6438

A. longipes

20.6815

−16.5913

PNBA: Kerekchet et Teintâne, extreme S

Mauritania

5177

A. longipes

20.7620

−16.6183

PNBA: Kerekchet et Teintâne, W side 3

Mauritania

6317

A. longipes

19.6522

−16.2803

PNBA: Kôra

Mauritania

6318

A. longipes

19.6522

−16.2803

PNBA: Kôra

Mauritania

2746

A. longipes

20.1281

−16.0893

PNBA: Oued Nouafferd

Mauritania

5137

A. longipes

20.1507

−16.1211

PNBA: Oued Nouafferd 1

Mauritania

6374

A. longipes

20.0845

−16.1313

PNBA: Oued Nouafferd, 2 km S of

Mauritania

6436

A. longipes

20.7938

−16.5462

PNBA: Sebkhet Dbâdeb et Teintâne, W margin

Mauritania

6352

A. longipes

19.7942

−16.2101

PNBA: Taguîlâlet Jreik

Mauritania

6356

A. longipes

19.8455

−16.2014

PNBA: Taguîlâlet Jreik, 1 km W of

Mauritania

6302

A. longipes

19.5863

−16.3268

PNBA: Toueigueret, 1 km SW of

Mauritania

6306

A. longipes

19.5842

−16.3514

PNBA: Toueigueret, 2 km SW of

Mauritania

A768

A. scutellatus

33.5833

2.9500

Bou Trekfine

Algeria

A787

A. scutellatus

22.7666

25.6000

Gilf Kebir

Egypt

A133

A. scutellatus

32.8968

12.1536

Jadi Resort; 7 km E of Zuara

Libya

8992

A. scutellatus

32.3665

−1.3191

Oued Es Safsaf, dunes above dam

Morocco

A086

A. scutellatus

33.9000

8.0489

Tozeur, 7 km W of

Tunisia

5823

A. taghitensis

22.8047

−12.3783

Zouérat, 11 km NE of

Mauritania

Coordinates are in decimal degrees (WGS84 projection)

PNBA Parc National du Banc d’Arguin

Fig. 1

Distribution of genotyped samples used for Acanthodactylus aureus, A. dumerili/senegalensis and A. longipes. White circles correspond to Pop1, while grey circles correspond to Pop2. Circles are proportional to sample size. The rectangle in the map of A. aureus represents the area depicted in the maps of A. dumerili/senegalensis and A. longipes. The samples sizes of the populations are the following: Pop1 = 21 and Pop2 = 17 in A. aureus; Pop1 = 24 and Pop2 = 19 in A. dumerili/A. senegalensis; and Pop1 = 14 and Pop2 = 19 in A. longipes

Results and discussion

MICRO-CHECKER revealed no evidence of allelic dropout or stuttering, and no heterozygote excess was observed. In addition, no loci appeared to be in linkage disequilibrium. Table 3 summarizes occurrence of heterozygote deficiency and suspected null alleles for all loci in all populations in the three target species. While the occurrence of null alleles would limit the use of some of these markers in the affected species, other departures from Hardy–Weinberg equilibrium probably result from pooling several sampling localities in the same “populations” (see above). Additionally, even markers showing such evidences might be adequate to apply in other populations and they are applicable in at least one of these species.
Table 3

Observations of heterozygote deficiency and null alleles

 

A. aureus

A. longipes

A. dumerili/senegalensis

Pop1

Pop2

Pop1

Pop2

Pop1

Pop2

Het. Def.

Null alleles

Het. Def.

Null alleles

Het. Def.

Null alleles

Het. Def.

Null alleles

Het. Def.

Null alleles

Het. Def.

Null alleles

Ac4

     

*

 

*

Ac5

        

*

*

  

Ac6

*

*

*

*

*

*

*

*

Ac13

         

*

 

*

Ac16

*

*

 

*

    

Ac19

      

*

*

    

Ac23

       

*

    

Ac31

      

*

*

 

*

 

*

Ac32

         

*

 

*

Ac33

*

*

*

*

    

*

*

  

Ac43

        

*

*

 

*

Ac45

  

*

*

        

Results are presented for Acanthodactylus aureus, A. dumerili/senegalensis and A. longipes. Significant values after Bonferroni correction are marked with an asterisk. Since the heterozygote deficiency was estimated in GENEPOP while null alleles were assessed in MICROCHECKER, differences in the estimation methods may explain the observed lack of concordance between heterozygote deficiency and null alleles in some cases

–, markers that failed to amplify in a certain species

All loci genotyped for each species were polymorphic (Table 4), except for Ac44 that amplified only for A. longipes. The Ac36 was also monomorphic in A. dumerili/A. senegalensis tested populations but polymorphism was observed in inland samples of this species (own unpublished data, Lopes, Velo-Antón, Crochet, Brito). The number of alleles per locus varied between 5 and 19 in A. aureus, and between 1 and 9 in A. dumerili/A. senegalensis and A. longipes. Expected and observed heterozygosity varied, respectively, between 0.594–0.893/0.188–1.000 in A. aureus, 0.223–0.829/0.154–0.826 in A. dumerili/A. senegalensis (ignoring Ac36), and 0.046–0.862/0.048–0.905 in A. longipes (ignoring Ac44). Most markers amplified in both A. scutellatus/17 loci) and A. taghitensis (16 loci).
Table 4

Characterization of the 22 microsatellite loci

 

A. aureus

A. longipes

A. dumerili/senegalensis

A. scutellatus

A. taghitensis

Pop1

Pop2

 

Pop1

Pop2

 

Pop1

Pop2

 

N

He

Ho

N

He

Ho

N alleles

Size range in bp

N

He

Ho

N

He

Ho

N alleles

Size range in bp

N

He

Ho

N

He

Ho

N alleles

Size range in bp

N

N alleles

Size range in bp

N

N alleles

Size range in bp

Ac1

20

0.63

0.70

17

0.70

0.59

5

251–267

14

0.25

0.14

21

0.25

0.24

3

271–279

24

0.22

0.25

18

0.29

0.28

4

267–279

2

2

267–271

1

1

263

Ac4

21

0.88

0.76

16

0.89

1.00

16

230–275

6

0.67

0.00

5

0.74

0.20

5

278–290

 

Ac5

21

0.82

0.90

17

0.89

0.94

13

162–198

14

0.60

0.79

21

0.64

0.71

6

141–162

24

0.79

0.54

19

0.61

0.53

7

159–177

5

7

153–182

1

1

197

Ac6

17

0.72

0.35

16

0.76

0.19

9

121–145

24

0.75

0.50

17

0.79

0.35

8

115–136

5

5

109–139

1

1

121

Ac8

21

0.82

0.76

5

0.78

1.00

10

201–231

14

0.68

0.71

21

0.77

0.71

7

204–234

24

0.38

0.29

19

0.33

0.32

4

198–210

4

4

204–228

1

2

213–216

Ac9

21

0.87

0.86

17

0.85

0.76

17

190–244

 

Ac13

21

0.83

0.95

17

0.74

0.71

9

140–179

14

0.72

0.64

21

0.69

0.67

8

140–164

23

0.39

0.17

18

0.45

0.28

4

134–161

5

6

134–164

1

1

155

Ac14

21

0.59

0.52

17

0.66

0.53

12

221–266

14

0.24

0.29

21

0.41

0.38

2

118–121

23

0.59

0.61

19

0.45

0.47

3

221–227

3

3

218–224

1

1

224

Ac16

16

0.75

0.31

17

0.79

0.53

8

101–125

14

0.45

0.43

21

0.63

0.57

5

92–113

 

4

4

95–110

Ac19

19

0.87

0.79

6

0.79

0.67

13

208–244

10

0.54

0.40

15

0.72

0.33

6

211–226

24

0.40

0.33

19

0.39

0.42

4

208–217

3

3

214–226

1

1

211

Ac20

17

0.87

0.82

12

0.85

0.67

14

150–201

14

0.65

0.79

21

0.71

0.81

5

168–180

23

0.74

0.83

19

0.76

0.79

9

169–186

1

1

168

1

1

171

Ac23

21

0.67

0.57

17

0.82

0.82

10

116–146

14

0.76

0.64

20

0.76

0.55

7

114–138

24

0.73

0.71

19

0.74

0.68

8

114–135

5

4

123–132

1

2

120–126

Ac31

16

0.80

0.69

17

0.76

0.76

14

306–366

12

0.67

0.58

18

0.59

0.22

7

312–333

23

0.69

0.52

18

0.78

0.56

7

309–327

3

4

321–339

1

2

321–330

Ac32

21

0.85

0.81

15

0.86

0.87

13

232–277

13

0.77

0.77

21

0.86

0.90

9

245–269

20

0.82

0.65

17

0.69

0.41

8

253–274

4

4

254–272

1

2

254–260

Ac33

21

0.83

0.52

16

0.86

0.63

15

120–165

14

0.70

0.50

16

0.63

0.56

5

129–153

23

0.55

0.39

16

0.66

0.50

4

132–144

5

4

132–141

1

2

129–138

Ac36

21

0.84

0.86

16

0.84

0.81

12

110–152

14

0.50

0.50

21

0.36

0.38

2

113–116

23

0.00

0.00

18

0.00

0.00

1

107

4

4

110–119

1

2

128–137

Ac43

18

0.81

0.78

17

0.83

0.71

10

94–124

12

0.61

0.58

21

0.80

0.76

8

106–130

24

0.83

0.50

15

0.82

0.53

9

103–127

4

4

106–126

Ac44

10

0.00

0.00

20

0.00

0.00

1

202

Ac45

19

0.85

0.95

17

0.68

0.47

12

133–172

12

0.00

0.00

21

0.05

0.05

2

136–157

24

0.62

0.75

19

0.75

0.74

7

136–157

5

6

136–166

1

2

136–163

Ac47

16

0.83

0.75

17

0.80

0.71

19

187–262

11

0.00

0.00

20

0.14

0.15

2

193–196

1

1

201

Ac49

17

0.81

0.65

17

0.79

0.71

14

186–225

1

1

198

1

1

201

Ac28

16

0.72

0.81

17

0.80

0.65

9

127–166

Mean

20

0.82

0.76

17

0.80

0.71

12

 

14

0.61

0.5

21

0.64

0.47

5

 

24

0.62

0.5

18

0.66

0.47

7

 

4

4

 

1

1

 

Sample size (N), number of alleles, allelic size range (expressed in base pairs), expected heterozygosity (He), and observed heterozygosity (Ho) are indicated for Acanthodactylus aureus, A. dumerili/A. senegalensis and A. longipes. Sample size, number of alleles, and allelic range are also presented for A. scutellatus and A. taghitensis

–, markers that failed to amplify in a certain species

Although the applicability of each marker may depend on the species considered, the information provided in our work allows a selection of good markers for future use on assessments of genetic structure, genetic diversity, gene flow, and demographic inferences, expanding the possible themes for evolutionary, behavioural and conservation studies in this species group.

Declarations

Authors’ contributions

SCL carried out the laboratory tasks, performed the molecular analyses, and drafted the manuscript. PP and SL participated in the microsatellite marker optimization and validation. GVA, PAC and RG contributed to the molecular analyses. JCB designed and supervised the study. All authors read and approved the final manuscript.

Acknowledgements

This study was partially supported by Mohammed bin Zayed Species Conservation Fund (project 11052709), by National Geographic Society (Grants CRE 7629-04 and 8412-08), by FEDER funds through the Operational Programme for Competitiveness Factors—COMPETE (FCOMP-01-0124-FEDER-028276), and by National Funds through FCT, Foundation for Science and Technology (PTDC/BIA-BIC/2903/2012). Research conducted in the scope of the LIA known as “Biodiversity and Evolution”. GVA, RG and JCB are supported by FCT contracts (IF/01425/2014, IF/00564/2012, and IF/00459/2013, respectively).

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
CIBIO/InBIO, Centro de Investigação em Biodiversidade e Recursos Genéticos, Universidade do Porto. Campus Agrário de Vairão
(2)
Departamento de Biologia, Faculdade de Ciências, Universidade do Porto. Rua Campo Alegre s/n
(3)
CNRS-UMR 5175, Centre d’Ecologie Fonctionnelle et Evolutive

References

  1. Salvador A. A revision of the lizards of the genus Acanthodactylus (Sauria: Lacertidae). Bon Zool Monog. 1982;16:1–167.Google Scholar
  2. Arnold EN. Osteology, genitalia and the relationships of Acanthodactylus (Reptilia: Lacertidae). Bull Brit Mus Nat Hist (Zoology). 1983;44:291–339.Google Scholar
  3. Crochet PA, Geniez P, Ineich I. A multivariate analysis of the fringe-toed lizards of the Acanthodactylus scutellatus group (Squamata: Lacertidae): systematic and biogeographical implications. Zool J Linnean Soc. 2003;137:117–55.View ArticleGoogle Scholar
  4. Harris D, Arnold E. Elucidation of the relationships of spiny-footed lizards, Acanthodactylus spp. (Reptilia: Lacertidae) using mitochondrial DNA sequence, with comments on their biogeography and evolution. J Zool. 2000;252:351–62.View ArticleGoogle Scholar
  5. Bons J. Les lacertiliens du Sud-Ouest Marocain: systématique, répartition géographique, éthologie, écologie). Trav Inst Sci Chérifien. 1959;18:1–130.Google Scholar
  6. Mellado J, Olmedo G. El género Acanthodactylus en Marruecos: problemas de identificación en los grupos de especies A. pardalis y A. scutellatus. Amphib Reptilia. 1990;11:131–46.View ArticleGoogle Scholar
  7. Baha El Din SM. A contribution to the herpetology of Sinai. Brit Herp Soc Bul. 1994;48:18–27.Google Scholar
  8. Baha El Din SM. A new lizard of the Acanthodactylus scutellatus group (Squamata: Lacertidae) from Egypt. Zool Middle East. 2007;40:21–32.View ArticleGoogle Scholar
  9. Sindaco R, Jeremcenko VK. The reptiles of the Western Palearctic: annotated checklist and distributional atlas of the turtles, crocodiles, amphisbaenians and lizards of Europe, North Africa, Middle East and Central Asia. Latina: Edizioni Belvedere, Monografie della Societas Herpetologica Italica; 2008.Google Scholar
  10. Schlotterer C. The evolution of molecular markers: just a matter of fashion? Nat Rev Genet. 2004;5:63–9.PubMedView ArticleGoogle Scholar
  11. Wan QH, Wu H, Fujihara T, Fang SG. Which genetic marker for which conservation genetics issue? Electrophoresis. 2004;25:2165–76.PubMedView ArticleGoogle Scholar
  12. Selkoe KA, Toonen RJ. Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecol Lett. 2006;9:615–29.PubMedView ArticleGoogle Scholar
  13. Malausa T, Gilles A, Meglecz E, Blanquart H, Duthoy S, Costedoat C, et al. High-throughput microsatellite isolation through 454 GS-FLX titanium pyrosequencing of enriched DNA libraries. Mol Ecol Res. 2011;11:638–44.View ArticleGoogle Scholar
  14. Schuelke M. An economic method for the fluorescent labelling of PCR fragments. Nat Biotech. 2000;18:233–4.View ArticleGoogle Scholar
  15. Van Oosterhout C, Hutchinson WF, Wills DP, Shipley P. MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes. 2004;4:535–8.View ArticleGoogle Scholar
  16. Peakall R, Smouse PE. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics. 2012;28:2537–9.PubMed CentralPubMedView ArticleGoogle Scholar

Copyright

© Lopes et al. 2015

Advertisement