Open Access

Identification and characterization of thirty novel microsatellite DNA markers from the Chinese mitten crab Eriocheir sinensis expressed sequence tags

BMC Research Notes20169:105

https://doi.org/10.1186/s13104-016-1909-6

Received: 17 September 2015

Accepted: 3 February 2016

Published: 17 February 2016

Abstract

Background

The Chinese mitten crab Eriocheir sinensis is an economically important decapod crustacean in China. Despite a widespread distribution and production in China, the resources of E. sinensis have experienced a dramatic decline in the past decades. Here we describe a new set of novel polymorphic microsatellite loci to facilitate the investigation of genetic structure and artificial breeding.

Results

In this study, a set of 30 novel polymorphic microsatellite markers for E. sinensis was developed from EST databases. The number of alleles per locus ranged from three to twenty. The observed and expected heterozygosities ranged from 0.047 to 0.932 and from 0.047 to 0.935, respectively.

Conclusions

These informative microsatellite markers will be useful in studies of genetics, genomics and marker-assisted selection breeding in E. sinensis.

Keywords

Microsatellites EST Chinese mitten crab Eriocheir sinensis

Findings

Background

The Chinese mitten crab Eriocheir sinensis is one of the most economically important aquaculture species in China [1] due to its taste and nutritious value, with a native range extending from the coastal estuaries of Korea in the north to the Fujian province of China in the south. However, the wild populations of E. sinensis have experienced a dramatic decline in the past decades due to overfishing and water pollution [2]. In China, the basic production technology of mitten crab populations has had a long history, with the conventional selective breeding programs based on phenotypic assessment. At present, the yield of E. sinensis is almost completely from artificial breeding. Unfortunately, like many other cultured species, the aquaculture performance of E. sinensis has declined significantly. In order to protect genetic diversity and prevent population degradation, understanding population genetic structure and genetic connectivity among populations and making a genetic linkage map are necessary.

Microsatellite markers provide a powerful tool in genome researches due to their wide distribution, codominant inheritance and high polymorphism. To date, approximately 83 microsatellite markers have been developed and applied for E. sinensis [38]. Although the number of described loci is relatively high, much more works is still needed because of the large diploid chromosome number of E. sinensis (2n = 146) [9]. In this study, we describe a new set of 30 EST-derived microsatellite markers which would aid in characterizing population structure, genetic diversity and constructing linkage map in E. sinensis.

Experimental section

A total of 17067 E. sinensis ESTs obtained from the GenBank database (2013) were screened using SSRIT program [10] that was designed to find regions containing microsatellites. The parameters were set for detection of di-, tri- and tetranuclotide motifs with a minimum of six repeats, respectively. Eighty-five microsatellite loci were selected for microsatellite marker optimization. Primers flanking microsatellite were designed using the PRIMER PREMIER 5.0 program.

Sixty cultured E. sinensis individuals were randomly captured from Xieyuan Fishing Company in Qilihai region in Tianjin City, China. Genomic DNA was extracted from the leg muscles using a modified phenol-chloroform protocol [11]. Polymerase chain reaction (PCR) amplifications were performed in 10-μL volumes containing 0.25 U Taq DNA polymerase (Takara), 1× PCR buffer, 0.2 mM dNTP mix, 1 μM of each primer set, 1.5 mM MgCl2 and about 100 ng template DNA. The PCR profiles for all loci were an initial denaturing at 94 °C for 3 min, followed by 35 cycles of 1 min at 94 °C, 1 min at the annealing temperatures listed in Table 1, and 1 min at 72 °C, with a final extension step of 5 min at 72 °C on a MJ Research PTC-200 DNA Engine (Peltier Thermal Cycler). Amplification products were resolved via 6 % denaturing polyacrylamide gel, and visualized by silver-staining. A 10-bp DNA ladder (Invitrogen) was used as a reference marker for allele size determination. The calculations of observed and expected heterozygosities were estimated with the program MICROSATELLITE ANALYSER software [12]. Tests for linkage disequilibrium and deviations from Hardy–Weinberg equilibrium (HWE) were performed using GENEPOP 4.2 [13, 14].
Table 1

Characterization of 30 EST-SSRs in the Chinese mitten crab Eriocheir sinensis

Locus

GenBank accession no.

Repeat motif

Primer sequence (5′–3′)

T a (°C)

No. of individuals

No. of alleles

Size range (bp)

H O

H E

P value

ES27

FL571941

(GT)11

F: TGTGATGAGAAGAAACCAAAGA

52

59

8

107–123

0.712

0.797

0.0005*

R: AATACCTGCTGGCGATGA

ES39

FG359711

(GT)17

F: AGGACGAAAGTTGGAGGG

55

56

8

114–128

0.482

0.864

0.0000*

R: AAATACAAATCTACGGGAGACAC

ES104

FL569100

(TG)21

F: TCACAACTACGAAAACCT

48

53

3

190–200

0.047

0.047

1.0000

R: GAGTGTCAGTGTATGGAAT

ES108

FG984086

(GT)19

F: GTAAACCCTACGAAACCATA

54

59

15

91–119

0.932

0.932

0.0000*

R: ACTCCCTAAACTACCTAACTACCA

ES130

FL570152

(GGC)7

F: CGTTCGTTGTGAGCGTCTGC

57

60

4

145–154

0.167

0.159

1.0000

R: CGCCTGGTCCATCTCATCG

ES212

FG984116

(CCA)6(CAA)10

F: GTGACACTGATGCCTGACGA

55

56

4

181–190

0.482

0.583

0.2114

R: TTATGCCTTTATTGACCGAGAC

ES271

FG359821

(TG)12

F: GCTTCTCACCCGTGATGT

54

49

6

176–186

0.615

0.754

0.0065

R: CTCCTCCTTTGCTTTCTTTA

ES352

FL572494

(GT)10

F: CACTCGGTACAAACATCAC

53

56

17

91–127

0.768

0.929

0.0000*

R: AATGGGTATGGATTTAGTGT

ES582

FL570362

(GA)26

F: ACCTCCAAGCCCCTTACC

53

58

5

241–261

0.293

0.296

0.6958

R: GAACAAACACGAGGGACAAC

ES584

FL574606

(CA)22

F: AGGGAAGTTGTAAAGGTAAGGA

49

56

9

222–240

0.429

0.863

0.0000*

R: ATGGGAATGAGATGAGGATAGA

ES645

FL571837

(AC)13

F: GACGCACGACAACAACCTC

60

56

11

122–158

0.522

0.912

0.0000*

R: CCACTCCTAGTCAACGGAAAGA

ES709

FL574505

(GCA)7

F: GCAGCCACAACCAGCAGAAG

60

60

6

197–212

0.233

0.219

1.0000

R: CTCGCCATGCAGGATCACC

ES776

FG357327

(CA)34

F: GTTGGTGTTGAAGGAGCCA

53

59

4

204–220

0.410

0.557

0.1180

R: CTTAATCCGTTGCGTCAGC

ES789

GE340666

(GT)25

F: TCGGGTGAGTTAGGTGTAGG

52

53

18

178–218

0.170

0.929

0.0000*

R: AGCAAGGCACTTTGAAGC

ES851

GE340258

(CAC)7

F: TCCAACCAGGCGGCAAAG

54

54

7

216–240

0.778

0.814

0.0580

R: AGCAAGTCCACCGAACACCAT

ES911

FL569216

(TTCA)7

F: CGGCGAGACTCACGAACT

56

53

5

242–258

0.453

0.634

0.0012*

R: CGAGGGTGAAGAGGCATT

ES998

FL572952

(GT)5N(TG)5N2(TG)12

F: CGACGGTGTCAGATTAGTG

56

51

8

217–231

0.392

0.860

0.0000*

R: ACCAACGGGCTCAAGAAG

ES1045

FL575077

(GT)28

F: GGAGCACCACCGTAAAGATA

55

55

17

112–148

0.582

0.935

0.2415

R: TCAACACGAAACCGCCAC

ES1053

FL572054

(CA)10

F: CTACACCAAGACCTCCTCGT

57

58

6

145–155

0.741

0.703

0.3476

R: GGCTGGTTTGTTGGGTAAG

ES1126

FG359126

(AAGG)12

F: TGTCCAGTCTCCCATCAA

54

60

14

180–240

0.883

0.907

0.7140

R: TGGTATGGTCGCTAATCTC

ES1139

FL569992

(GA)11

F: ACAGACGCACCTCCAAGC

55

59

20

110–150

0.644

0.925

0.0000*

R: TTAGAACAAACACGAGGGACA

ES1171

FG357452

(AC)8N5(TC)6

F:CAATCTGCCCTAATCTGTCTGTAA

57

55

8

156–172

0.900

0.871

0.0000*

R:GGGAAAGGTAGGAGGATAAGTGA

ES1178

GE341515

(ACC)7

F: TCCCATCGCCGTAGAAAC

55

60

3

138–146

0.150

0.144

1.0000

R: ACGCCAGACTGGACAAGC

ES1240

FG982578

(TACA)11

F: ATTGTAGCCATACCAGCAT

52

60

13

152–200

0.883

0.890

0.3087

R: ACAAATCTTACAACTACGGC

ES1289

FL574500

(TTA)13

F: ACCTTGTGGATACCAGCAT

50

55

12

124–169

0.782

0.872

0.0000*

R: TTCCCTTCAACCATACATAA

ES1293

FL569028

(GTA)7N8(GTA)5

F: GCCTCAATATCGGGCTTAT

55

59

7

129–176

0.763

0.769

0.2826

R: CCTCCCTGCGACTTCTACT

ES1300

FL575122

(TG)10

F: CCCTTGTTGATTGCCCTA

55

52

5

186–194

0.519

0.608

0.0846

R: GTCACGAAGAAGCACCTC

ES1482

FL576108

(TG)7

F: ACTATCCCTGCCTCACTACCG

57

60

7

115–129

0.250

0.522

0.0000*

R: GAACAAACATTACCGTCACTCG

ES1507

FL572842

(AGT)5N2(TAG)9

F: TGGAGTAGGTCGGTTCGGT

57

58

6

197–215

0.603

0.743

0.0299

R: TAGCAACATCCCTCGTCCTC

ES1513

FL574610

(AG)9

F: AACAGTGGCAGGAAACAGAAAG

57

56

7

100–114

0.217

0.739

0.0000*

R: AGGGAAGGATGAGTGTGAGCA

T a annealing temperature, H O observed heterozygosity, H E expected heterozygosity

* Significant departure (P < 0.05) from expected Hardy–Weinberg equilibrium conditions after correction for multiple tests (k = 30)

Results and discussion

Of the 85 potential microsatellite markers, forty-four loci were successfully amplified with the expected products. Thirty of them revealed polymorphism among the tested 60 individuals of E. sinensis. The number of alleles at each locus ranged from three to twenty with an average of 8.767 alleles per locus (Table 1). Observed heterozygosities ranged from 0.047 to 0.932 with an average of 0.527, while expected heterozygosities ranged from 0.047 to 0.935 with an average of 0.693. The mean number of alleles per locus, H O and H E demonstrated a relatively high genetic diversity within crab individuals. This was similar to reports from studies in other locations [3, 4, 6, 8]. Fourteen of the 30 loci significantly deviated from the Hardy–Weinberg equilibrium after Bonferroni correction. This might be due to the limited sample size, and/or the presence of null alleles at these loci. The high polymorphism of the loci suggests that they would be useful tool in studies of population structure, genetic diversity and the construction of genetic map for E. sinensis.

Conclusions

A set of 30 novel hypervariable microsatellite loci in E. sinensis was reported in this study. All the characterized microsatellite markers are suited for assessing the genetic diversity and the population structure, and also facilitate marker-assisted selection breeding of E. sinensis.

Ethics statement

Every effort was made to minimize animal pain, suffering and distress and to reduce the number of animal used. Sampling of the crabs was approved by Tianjin Diseases Prevention and Control Center of Aquatic Animals.

Availability of the supporting data

The microsatellite sequences are available through the National Centre for Biotechnology Information (http://www.ncbi.nlm.nih.gov); GenBank accession numbers see Table 1.

Declarations

Authors’ contributions

JS was responsible for the design of this study, supervision of the work and contributed to the interpretation of results. JL performed field sampling, data analysis and marker validation, and drafted the manuscript. XG coordinated field sampling and was responsible for the implementation of the study. LC contributed to analysis of sequences. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by Grants of the National High-Tech Research and Development Program of China (863 programs, 2012AA10A401), National Key Technology R&D Program (2012BAD26B04-05), Tianjin Technical Supporting Program of Tianjin (12ZCDZNC05500) and Research and Extension Projects of Tianjin Fishery Bureau (J2013-21) (J2013-7).

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Tianjin Key Laboratory for Animal and Plant Resistance, College of Life Sciences, Tianjin Normal University
(2)
Tianjin Diseases Prevention and Control Center of Aquatic Animals
(3)
Tianjin Key Laboratory of Aqua-Ecology and Aquaculture, Fisheries Science Department, Tianjin Agricultural University

References

  1. Zhang SY, Fu HT, Qiao H, Sun SM. Research progresson geneticsand breeding of Eriocheir sinensis. Chin Agric Sci Bull. 2013;29:39–45.Google Scholar
  2. Li SF. The problem and measures of Eriocheir sinensis industry. Sci Fish Farm. 2006;6:1–2.Google Scholar
  3. Hanfling B, Weetman D. Characterization of microsatellite loci for the Chinese mitten crab, Eriocheir sinensis. Mol Ecol Notes. 2003;3:15–7.View ArticleGoogle Scholar
  4. Chang YM, Liang LQ, Li SW, Ma HT, He JG, Sun XW. A set of new microsatellite loci isolated from Chinese mitten crab, Eriocheir sinensis. Mol Ecol Notes. 2006;6:1237–9.View ArticleGoogle Scholar
  5. Zhu ZY, Shi YH, Le GW. Isolation and characterization of polymorphic microsatellites from Chinese mitten crab, Eriocheir sinensis. Mol Ecol Notes. 2006;6:838–9.View ArticleGoogle Scholar
  6. Mao RX, Zhao YY, Liu FJ, Jia ZY, Hou N, Chang YM, Lu CY, Liang LQ, Sun XW. Development and characterization of new microsatellite loci from Chinese mitten crab (Eriocheir sinensis). Conserv Genet. 2009;10:1117–9.View ArticleGoogle Scholar
  7. Gao XG, Li HJ, Li YF, Sui LJ, Zhu B, Liang Y, Liu WD, He CB. Sixteen polymorphic simple sequence repeat markers from expressed sequence tags of the Chinese mitten crab Eriocheir sinensis. Int J Mol Sci. 2010;11:3035–8.PubMed CentralView ArticlePubMedGoogle Scholar
  8. Xiong LW, Wang Q, Qiu GF. Large-scale isolation of microsatellites from Chinese mitten crab Eriocheir sinensis via a solexa genomic survey. Int J Mol Sci. 2012;13:16333–45.PubMed CentralView ArticlePubMedGoogle Scholar
  9. Du NS, Lai W, Xue LZ. The chromosomes of the Chinese mitten-handed crab, Eriocheir sinensis (Crustacea, Decapoda). Zool Res. 1986;7:293–6.Google Scholar
  10. Temnykh S, DeClerck G, Lukashova A, Lipovich L, Cartinhour S, McCouch S. Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): frequency, length variation, transposon associations, and genetic marker potential. Genome Res. 2001;11:1441–52.PubMed CentralView ArticlePubMedGoogle Scholar
  11. Li Q, Park C, Kijima A. Isolation and characterization of microsatellite loci in the Pacific abalone, Haliotis discus hannai. J Shellfish Res. 2002;21:811–5.Google Scholar
  12. Dieringer D, Schlötterer C. Microsatellite analyser (MSA): a platform independent analysis tool for large microsatellite data sets. Mol Ecol Notes. 2003;3:167–9.View ArticleGoogle Scholar
  13. Raymond M, Rousset F. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Heredity. 1995;86:248–9.Google Scholar
  14. Rousset F. Genepop’007: a complete reimplementation of the Genepop software for Windows and Linux. Mol Ecol Resour. 2008;8:103–6.View ArticlePubMedGoogle Scholar

Copyright

© Li et al. 2016

Advertisement