Open Access

Novel microsatellite markers for Distylium lepidotum (Hamamelidaceae) endemic to the Ogasawara Islands

BMC Research Notes20169:332

https://doi.org/10.1186/s13104-016-2137-9

Received: 14 April 2016

Accepted: 24 June 2016

Published: 2 July 2016

Abstract

Background

Distylium lepidotum is a small tree endemic to the Ogasawara Islands located in the northwestern Pacific Ocean. This species is a sole food for an endemic locust, Boninoxya anijimensis. Here, we developed microsatellite markers to investigate genetic diversity and genetic structure and to avoid a genetic disturbance after transplantation to restore the Ogasawara Islands ecosystem.

Results

Microsatellite markers with perfect dinucleotide repeats were developed using the next-generation sequencing Illumina MiSeq Desktop Sequencer. Thirty-two primer pairs were characterized in two D. lepidotum populations on Chichijima and Hahajima Islands of the Ogasawara Islands. The number of alleles for the markers ranged from three to 23 per locus in the two populations. Expected heterozygosity per locus in each population ranged from 0.156 to 0.940 and 0.368 to 0.845, respectively.

Conclusions

These microsatellite markers will be useful for future population genetics studies of D. lepidotum and provide a basis for conservation management of the Ogasawara Islands.

Keywords

Distylium lepidotum Next-generation sequencing Ogasawara Islands Population genetics Simple sequence repeat

Findings

Background

Microsatellite markers, or simple sequence repeats, are widely applicable as DNA-based markers for population genetics studies. Moreover, their cost-effective development has been increasingly facilitated by applying next-generation sequencing (NGS) technologies [20].

Distylium lepidotum Nakai (Hamamelidaceae) is a small tree endemic to the oceanic Ogasawara Islands in the northwestern Pacific Ocean. The species is the dominant tree in the DistyliumPouteria dry scrub [18], which is inhabited by Boninoxya anijimensis Ishikawa, a locust recorded as a new genus and species [8]. The locust utilizes D. lepidotum as the sole food, i.e., it is monophagous [8, 9]. Although it is only distributed on Anijima Island of the Ogasawara Islands, it has been exposed to alien predatory species such as Anolis carolinensis. Conservation/benign introduction measures of B. anijimensis are needed on the Ogasawara Islands, except Anijima Island, to protect the B. anijimensis populations. As D. lepidotum is an essential food source, it may be possible to transplant the species. Therefore, it is important to reveal the genetic structure of the species to minimize any genetic disturbance due to the transplant. Here, we developed microsatellite markers to investigate the genetic diversity and structure in D. lepidotum.

Methods

Microsatellite markers were developed for D. lepidotum using an Illumina MiSeq Desktop Sequencer (Illumina, San Diego, CA, USA). Total genomic DNA was extracted from one silica-gel dried D. lepidotum leaf sample collected from Chibusayama (26°39′17.4″N 142°10′03.6″E) on Hahajima Island of the Ogasawara Islands using a DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). A shotgun library was prepared using the Nextera DNA Sample Preparation Kit v2 (Illumina), and the raw de novo sequencing data were obtained using the MiSeq Reagent Kit v2 (500 cycles) (Illumina). The raw reads were divided into each index, extra sequences (adapters and indices) were trimmed, and FASTAQ files were generated using the MiSeq Reporter v.2.5.1 (Illumina). The paired-end reads were merged using PEAR 0.9.6 [21] with default parameter settings. After the paired-end assembly, the low quality reads (<95 % with Phred quality score of 30) were removed using the script fastq_quality_filter included in the FASTX-Toolkit v.0.0.14 [7]. The resulting FASTQ files were converted to FASTA format using the ShortRead package [12]. A total of 1734,031 contigs with an average length of 241 bp were obtained.

The microsatellites were identified and the primer pairs were designed with QDD2.1 [11]. A total of 41,367 unique sequences containing pure/compound microsatellite regions (2–6 nucleotide motifs with >5 repeats) and primer-designable flanking regions were selected. The primer pairs were designed with Primer3 [17] and implemented in QDD2.1 using the following criteria: (1) polymerase chain reaction (PCR) product size of 90–500 bp and (2) primer lengths of 20–27 bp, melting temperature of 57–63° C, and GC content of 20–80 %. Finally, 18,239 microsatellite primer pairs were designed using Primer3.

Amplification and polymorphism were confirmed in 48 selected primer pairs after considering the microsatellites (one single dinucleotide motif with more than ten repetitions), design type (“A” or “B” in QDD2.1), and PCR product size to apply multiplex amplification (Table 1). Four universal primers with different fluorescent tags designed by Blacket et al. [1] were prepared, and the 5′ end of each forward primer was attached to the same sequence as a tail. In addition, as the 5′ end sequences of each reverse primer became 5′-GTTT-3′, a PIG-tail (5′-GTTT-3′, 5′-GTT-3′, 5′-GT-3′, or 5′-G-3′) was added to reduce stuttering due to inconsistent addition of adenine by Taq DNA polymerase [2].
Table 1

Characteristics of the 32 microsatellite markers developed for Distylium lepidotum

Locus

Repeat motif

Forward primer sequence (5′–3′)a

Reverse primer sequence (5′–3′)b

Ta (°C)

Size

range (bp)

GeneBank accession no.

Isu00524

(CT)30

[tail C] TTTATGCTTATTCACCCTTGAACC

gtttAAACACCCATTAGTTCTTCTGTCTG

57

136–194

LC085250

Isu01062

(TC)25

[tail B] TACGAATGATGGGTCAAACTGTAA

gtttGCCTTAAATTGACTGGAAGTGATT

57

228–270

LC085251

Isu01853

(AG)19

[tail D] CACTAGTTATTGAGGTAGGCGGGT

gTTTGTTAACGAATGAGTTGGGATT

57

274–302

LC085252

Isu03838

(TC)24

[tail D] TTCCTGAAACGGTTACACAATACA

gtttAGTGGAGATGATAAACGGATTGAC

57

111–135

LC085253

Isu04069

(GA)24

[tail B] TTAGATTTGAAGGCGATAAAGGTT

gttTCCTTGATCTGTCCAATGTCA

57

135–171

LC085254

Isu04385

(TC)22

[tail A] AATGGGTCAGTGAGAATCTGTCTT

gtttCAAGGAAATCGTATATGCAGAACA

57

215–245

LC085255

Isu04423

(GA)22

[tail B] AAGCAGAGCTTACCATGATTCACT

gttTAGATCTCTGAGGAGGGACACATT

57

260–308

LC085256

Isu04472

(AG)26

[tail D] ATTTGGATCATCACTCGAGGTAAA

gtTTATTCGTTTGCACTCTTATTTGA

57

214–266

LC085257

Isu04870

(CT)16

[tail B] TTAATTGGTTTCCCATTTGATCTC

gtttCATGCAGATGCAGACTCTAAGAAG

57

285–299

LC085258

Isu04950

(GA)22

[tail A] AGACAATTCTGTGCTCCAGTATCA

gtttAACATTGAAAGTTGAAGACCCAAC

57

263–299

LC085259

Isu04954

(TC)31

[tail A] CTAATCCAAATCAACCCATCTACG

gtttCACCTCTCGTTTACTTCCATTGAT

57

128–156

LC085260

Isu05730

(AT)11

[tail A] ACATCGTCACCTCTATTAACCGAC

gtttCAAGAGATTTCGAAGTGAAACAGA

57

346–366

LC085261

Isu06843

(AG)27

[tail B] GTTGACATCCCTACTCCTCCTACC

gttTCTAAGCAAATGTGCATCGTTAGT

57

96–132

LC085262

Isu07049

(CT)26

[tail A] TCCATGTATTTATTTCGATCCTCC

gtttGGGAAATACCATAAACATAAAGATGG

57

90–134

LC085263

Isu07063

(GA)24

[tail C] AGCTTGCATGAGGTTTCACTAAGA

gtttCGACAACAGTACTAATCAACACGG

57

109–143

LC085264

Isu09807

(GA)23

[tail D] AACGCAAGATTTATCATTACCAGC

gtttAAGACTCTCAAGATCTGTGCCAA

57

213–239

LC085265

Isu09853

(GA)22

[tail D] CAATTCCCTCAATTGTTGTTTCTT

gtttAGAAACTTAAAGACAAACCGGGAT

57

304–326

LC085266

Isu10193

(GA)24

[tail B] ATTTATGTGGAAGTAGTAGCCGGA

gttTACTGCTGGCTTGACATAGAAAGA

57

214–236

LC085267

Isu11459

(AG)19

[tail D] TAAAGCATCAAACAAGCGAATATG

gtttACAATAAGAAAGCGACATGCTCA

57

265–291

LC085268

Isu12115

(GA)11

[tail A] TACGATTCAAGCTTGTCATACTCG

gtttATATTTACGCGCAAACTCTCGC

57

413–417

LC085269

Isu12238

(CT)24

[tail D] CCAAGATTATGCAACCTAAGGAAG

gtttACCCTGAATTCCATCTAGACCTTT

57

116–156

LC085270

Isu12265

(TC)21

[tail C] TGATAGATACATGTCCCACTGTCTT

gttTAAACCTAGCCAAACAAATCCAAC

57

85–121

LC085271

Isu12586

(AT)11

[tail C] TAGACAACTTTCTGGATCAAAGCC

gtttGGCTGTGTATATGTATGCGTGTTT

57

319–359

LC085272

Isu13849

(CT)12

[tail D] CAAGATCAAGATTGAAATGGAATTG

gtttATCCGATAGATCAGTACTTGGTGG

57

326–350

LC085273

Isu13965

(AG)25

[tail B] GTGTAAGTTGTGGGTTTAACGGAT

gtttAAGACATCAGCAAACTAGTCCACC

57

155–183

LC085274

Isu15054

(TC)24

[tail A] CGGGATGTAAACATAGATGTCAAA

gttTATGGCCTAGGAAGATAATGTTGG

57

219–273

LC085275

Isu16246

(CT)26

[tail C] AATCATGTAGCGAGCTTGAACTTT

gtttCATGAATATGAGCACAAGGTATTATTT

57

132–174

LC085276

Isu16408

(TC)18

[tail C] AGATTACTGCTTCGTTCGACCTTA

gtTTGGTGCTATAATTAGGATTTGGC

57

285–307

LC085277

Isu16655

(CT)16

[tail C] GAAAGGTAGGTCCATAACTCCACA

gtTTGAGGATACAATGCTTTCACTTG

57

270–290

LC085278

Isu16805

(GA)26

[tail B] CGCTCTTAAACAGAATATGGAAGG

gtttGATTGTCAATTCCACGGAGAAC

57

83–115

LC085279

Isu17435

(AG)20

[tail B] TAAATACAAAGATGATGTGCCAGC

gttTGTACATGTAGTTCCCAGGCAAT

57

82–114

LC085280

Isu17619

(AG)13

[tail A] CAATTCCCTTGTGAAGAATTATCG

gtttGTTTACAGTACTGCACTGACGCAT

57

317–329

LC085281

Ta = annealing temperature

aTails of the forward primers are indicted as follows: [Tail A] = 5′-GCCTCCCTCGCGCCA-3′; [Tail B] = 5′-GCCTTGCCAGCCCGC-3′; [Tail C] = 5′-CAGGACCAGGCTACCGTG-3′; and [Tail D] = 5′-CGGAGAGCCGAGAGGTG-3′

bReverse primer sequences contained the PIG-tail sequence [2]. Tail sequences are shown in lower case letters

PCR amplification was performed using the QIAGEN Multiplex PCR Kit. Multiplex PCRs were performed for each of the four primer pair sets using the following thermal cycle conditions: initial denaturation for 15 min at 95° C, 35 cycles of denaturation for 30 s at 95° C, annealing for 1.5 min at 57° C, extension for 1 min at 72° C, and final extension for 30 min at 60° C. The PCR products were separated by capillary electrophoresis on an ABI3130 Genetic Analyzer (Life Technologies, Waltham, MA, USA) with the GeneScan 600 LIZ Size Standard (Life Technologies). The fragments were sized using GeneMapper 4.0 (Life Technologies).

We finally tested two populations from Chichijima and Hahajima Islands in the central part of the Ogasawara Islands to evaluate the allelic polymorphisms: 24 individuals from Asahiyama (27°05′40.7″N 142°12′35.6″E) on Chichijima Island and 20 individuals from Omotohama (26°37′28.9″N 142°10′41.7″E) on Hahajima Island. Voucher specimens of the representative individuals were deposited in the Makino Herbarium (MAK) of the Tokyo Metropolitan University, Japan (Asahiyama: no. MAK436933; Omotohama: no. MAK436934). The number of alleles per locus (N A), observed heterozygosity (H O), expected heterozygosity (H E), and fixation index (F IS) were calculated to characterize each locus using GenAlEx 6.501 [13]. The Hardy–Weinberg equilibrium (HWE) at each locus of each population and linkage disequilibrium (LD) between each locus pair in each population were tested with Genepop 4.0 [16]. In addition, the null allele frequencies (F Null) were estimated with CERVUS 3.07 [10]. To examine genetic differentiation between the two populations, Weir and Cockerham’s [19] estimate of pairwise F ST was calculated using FSTAT 2.9.3.2 [6]. The deviation of each pairwise F ST from zero was tested based on 1000 randomizations. Genetic structure was also evaluated by a Bayesian clustering method implemented in STRUCTURE 2.3.4 [4, 5, 15]. Markov chain Monte Carlo methods consisted of 100,000 burn-in steps and followed by 100,000 iterations. Ten replicate runs were performed at each K value from one to five under an admixture model with correlated allele frequencies. The log-likelihood probability at each run and the rate of change in the log-likelihoods between adjacent K values, ΔK [3], were calculated and compared across a range of K values to determine the best fit for the data.

Results and discussion

Of the 48 tested microsatellite markers, 32 primer pairs were polymorphic among 44 individuals (Table 1). N A ranged from three to 22 alleles in the Chichijima population and from one to nine alleles in the Hahajima population (Table 2). H E ranged from 0.156 to 0.940 in the Chichijima population and from 0.368 to 0.845 in the Hahajima population (Table 2). Locus Isu07063 in the Hahajima population was monomorphic; only one allele was found in six samples, and the remaining 14 samples were not successfully amplified, suggesting the existence of null alleles. In addition, F Null was high (Table 2). The Isu00524 locus in both populations deviated significantly from HWE. Significant deviations from HWE in the Chichijima or Hahajima populations were detected at several loci (Table 2; Isu04069, Isu07049, Isu10193, Isu12265, Isu15054, and Isu16805). These loci possibly involved null alleles, because null alleles are a common cause of apparent deviations from HWE [14]. Actually, F Null values were high in most of these loci (Table 2). However, these HWE deviations may have been caused by inbreeding, which can often occur in small populations. In either case, these loci should be used cautiously in further analyses. No significant LD was observed between the markers in the two populations.
Table 2

Genetic diversity of the 32 microsatellite markers in the two Distylium lepidotum populations

Locus

Chichijima Island

Hahajima Island

F Null

N

N A

H O

H E

F IS a

N

N A

H O

H E

F IS a

Isu00524

22

5

0.182

0.381

0.523*

20

5

0.450

0.650

0.308*

0.265

Isu01062

24

19

0.917

0.925

0.009

20

9

0.850

0.829

−0.026

0.018

Isu01853

24

12

0.875

0.891

0.018

20

8

0.750

0.836

0.103

0.038

Isu03838

24

8

0.625

0.800

0.219

20

6

0.700

0.749

0.065

0.116

Isu04069

24

9

0.375

0.793

0.527***

20

6

0.550

0.551

0.002

0.249

Isu04385

24

14

0.917

0.884

−0.037

20

7

0.950

0.788

−0.206

−0.032

Isu04423

24

16

0.750

0.844

0.111

20

8

0.850

0.826

−0.029

0.045

Isu04472

24

18

0.958

0.913

−0.049

20

6

0.600

0.613

0.020

0.026

Isu04870

24

4

0.833

0.702

−0.187

20

4

0.700

0.638

−0.098

−0.057

Isu04950

24

7

0.625

0.661

0.055

20

9

0.950

0.830

−0.145

0.050

Isu04954

24

7

0.583

0.582

−0.003

20

5

0.750

0.678

−0.107

0.032

Isu05730

24

8

0.833

0.816

−0.021

20

6

0.800

0.771

−0.037

−0.004

Isu06843

24

14

0.875

0.886

0.013

20

8

0.900

0.805

−0.118

−0.004

Isu07049

24

15

0.833

0.917

0.091

20

8

0.550

0.746

0.263*

0.109

Isu07063

17

9

0.235

0.843

0.721***

6

1

0.659

Isu09807

24

13

0.750

0.788

0.048

20

5

0.850

0.726

−0.170

−0.001

Isu09853

24

7

0.625

0.787

0.206

20

8

0.700

0.756

0.074

0.112

Isu10193

24

9

0.750

0.848

0.116

20

7

0.400

0.770

0.481**

0.174

Isu11459

24

8

0.625

0.500

−0.250

20

4

0.400

0.368

−0.088

−0.104

Isu12115

24

3

0.333

0.588

0.433

20

3

0.700

0.609

−0.150

0.141

Isu12238

24

12

0.958

0.858

−0.117

20

7

0.600

0.693

0.134

0.019

Isu12265

24

13

0.583

0.845

0.310**

20

7

0.800

0.800

0.000

0.126

Isu12586

24

14

0.875

0.862

−0.015

20

9

0.650

0.769

0.154

0.051

Isu13849

24

9

0.875

0.780

−0.122

20

4

0.500

0.524

0.045

−0.014

Isu13965

24

12

0.875

0.885

0.012

20

6

0.800

0.769

−0.041

0.010

Isu15054

24

22

0.833

0.940

0.114*

20

8

0.800

0.845

0.053

0.060

Isu16246

24

12

0.667

0.840

0.207

20

9

0.800

0.836

0.043

0.087

Isu16408

24

9

0.917

0.842

−0.089

20

7

0.600

0.578

−0.039

0.046

Isu16655

24

10

0.667

0.789

0.155

20

7

0.750

0.800

0.063

0.073

Isu16805

24

11

0.500

0.857

0.416*

20

8

0.500

0.701

0.287

0.284

Isu17435

24

12

0.833

0.838

0.005

20

6

0.800

0.703

−0.145

0.014

Isu17619

24

3

0.167

0.156

−0.067

20

3

0.600

0.496

−0.209

−0.047

Average

10.8

0.695

0.776

0.105

6.4

0.675

0.689

0.016

N = number of genotyped individuals; N A = number of alleles per locus; H O = observed heterozygosity; H E = expected heterozygosity; F IS = fixation index; F Null = null allele frequency

a Asterisks indicate significant deviation from Hardy–Weinberg equilibrium after Bonferroni correction (* P < 0.05, ** P < 0.01, *** P < 0.001)

Of all the 397 alleles that were detected, the 193 alleles which were detected in the Chichijima population were not found in the Hahajima population. On the other hand, the 53 alleles which were detected in the Hahajima population were not found in the Chichijima population. In addition, the two populations were significantly differentiated (F ST = 0.0971). The Bayesian clustering analysis represented the highest ΔK value at K = 2 (ΔK = 121.4; Appendix). The Chichijima population was almost entirely composed of the cluster I (dark gray); the Hahajima population generally comprised the cluster II (light gray) (Fig. 1). However, because admixture was observed in some individuals of the Hahajima population, the infrequent gene flow between islands might occur. These data indicated that these markers can be used to analyze population genetic structure in the future.
Fig. 1

Results of Bayesian clustering, STRUCTURE, at K = 2 of the two Distylium lepidotum populations. Vertical columns represent individual plants, and the heights of bars of each color are proportional to the posterior means of estimated admixture proportions. For population localities, see Table 1

Conclusions

These 32 novel microsatellite markers will be valuable for elucidating the genetic diversity and structure of D. lepidotum, since they have enough polymorphisms and they can clearly distinguish the two populations. The genetic data would be useful to investigate the genetic diversity and structure of D. lepidotum which is necessary for a food source of the endangered locust species on the Ogasawara Islands.

Abbreviations

F IS

fixation index

F Null

null allele frequency

H E

expected heterozygosity

H O

observed heterozygosity

HWE: 

Hardy–Weinberg equilibrium

LD: 

linkage disequilibrium

N A

number of alleles per locus

NGS: 

next-generation sequencing

PCR: 

polymerase chain reaction

Declarations

Authors’ contributions

KS performed field sampling, laboratory work, data analysis and marker validation, and drafted the manuscript. SS did the study design, performed field sampling and laboratory work. Both authors read and approved the final manuscript.

Acknowledgements

The authors thank A. Hisamatsu, Y. Kawamata, and other members of the Laboratory of Ecological Genetics and Tree Genetics of the Forestry and Forest Products Research Institute for their technical support. We are grateful to T. Yasui, Y. Hoshi, and other members of the Ogasawara Wild Life Research Society for collecting the plant samples. This study was financially supported by the Environment Research and Technology Development Fund of the Ministry of the Environment, Japan (4-1402).

Competing interests

The authors declare that they have no competing interests.

Availability of the supporting data

The sequences containing microsatellite motifs are available through the DNA Data Bank of Japan (http://www.ddbj.nig.ac.jp/index-e.html); GenBank accession numbers see Table 1.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Laboratory of Wildlife Ecology, Forestry and Forest Products Research Institute
(2)
Laboratory of Ecological Genetics, Forestry and Forest Products Research Institute

References

  1. Blacket MJ, Robin C, Good RT, Lee SF, Miller AD. Universal primers for fluorescent labelling of PCR fragments-an efficient and cost-effective approach to genotyping by fluorescence. Mol Ecol Res. 2012;12:456–63.View ArticleGoogle Scholar
  2. Brownstein MJ, Carpten JD, Smith JR. Modulation of non-templated nucleotide addition by taq DNA polymerase: primer modifications that facilitate genotyping. Biotechniques. 1996;20(1004–1006):1008–10.Google Scholar
  3. Evanno G, Regnaut S, Goudet J. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol Ecol. 2005;14:2611–20.View ArticlePubMedGoogle Scholar
  4. Falush D, Stephens M, Pritchard JK. Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics. 2003;164:1567–87.PubMedPubMed CentralGoogle Scholar
  5. Falush D, Stephens M, Pritchard JK. Inference of population structure using multilocus genotype data: dominant markers and null alleles. Mol Ecol Notes. 2007;7:574–8.View ArticlePubMedPubMed CentralGoogle Scholar
  6. Goudet J. Fstat v2.9.3.2. Universitity of Lausanne, Lausanne. 2002. http://www2.unil.ch/popgen/softwares/fstat.htm.  Accessed 12 Apr 2016.
  7. Hannon G. FASTX-Toolkit v.0.0.14. Cold Spring Harbor Laboratory, Long Island. 2009. http://hannonlab.cshl.edu/fastx_toolkit/. Accessed 12 Apr 2016.
  8. Ishikawa H. Occurrence of a New Grasshopper, Boninoxya anijimensis gen. et sp. nov. (Orthoptera, Acrididae, Oxyinae) in the Ogasawara Islands, Japan. Jpn J Syst Entomol. 2011;17:115–20.Google Scholar
  9. Ishikawa H. Boninoxya anijimensis, In: Natural Environment Division, Bureau Of Environment, Tokyo Metropolitan Government, editors. Red Data Book Tokyo: Islands version. Natural Environment Division, Bureau of Environment, Tokyo Metropolitan Goverment, Tokyo; 2014. p. 400. (in Japanese).Google Scholar
  10. Kalinowski ST, Taper ML, Marshall TC. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecol. 2007;16:1099–106.View ArticlePubMedGoogle Scholar
  11. Meglecz E, Costedoat C, Dubut V, Gilles A, Malausa T, Pech N, Martin J-F. QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects. Bioinformatics. 2010;26:403–4.View ArticlePubMedGoogle Scholar
  12. Morgan M, Anders S, Lawrence M, Aboyoun P, Pages H, Gentleman R. ShortRead: a bioconductor package for input, quality assessment and exploration of high-throughput sequence data. Bioinformatics. 2009;25:2607–8.View ArticlePubMedPubMed CentralGoogle Scholar
  13. Peakall R, Smouse PE. GENALEX 6: genetic analysis in excel. Population genetic software for teaching and research. Mol Ecol Notes. 2006;6:288–95.View ArticleGoogle Scholar
  14. Pemberton JM, Slate J, Bancroft DR, Barrett JA. Nonamplifying alleles at microsatellite loci—a caution for parentage and population studies. Mol Ecol. 1995;4:249–52.View ArticlePubMedGoogle Scholar
  15. Pritchard J, Stephens M, Donnelly P. Inference of population structure using multilocus genotype data. Genetics. 2000;155:945–59.PubMedPubMed CentralGoogle Scholar
  16. Rousset F. GENEPOP‘007: a complete re-implementation of the GENEPOP software for Windows and Linux. Mol Ecol Res. 2008;8:103–6.View ArticleGoogle Scholar
  17. Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Misener S, Krawetz SA, editors. Bioinformatics methods and protocols. Totowa: Humana Press; 2000. p. 365–86.Google Scholar
  18. Shimizu Y, Tabata H. Forest structures, composition, and distribution on a Pacific island, with reference to ecological release and speciation. Pac Sci. 1991;45:28–49.Google Scholar
  19. Weir BS, Cockerham CC. Estimating F-statistics for the analysis of population-structure. Evolution. 1984;38:1358–70.View ArticleGoogle Scholar
  20. Zalapa JE, Cuevas H, Zhu H, Steffan S, Senalik D, Zeldin E, McCown B, Harbut R, Simon P. Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences. Am J Bot. 2012;99:193–208.View ArticlePubMedGoogle Scholar
  21. Zhang J, Kobert K, Flouri T, Stamatakis A. PEAR: a fast and accurate Illumina Paired-End reAd mergeR. Bioinformatics. 2014;30:614–20.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s) 2016

Advertisement