Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Research Notes

Open Access

Development and characterization of microsatellite markers in the African forest elephant (Loxodonta cyclotis)

Contributed equally
BMC Research Notes20169:364

https://doi.org/10.1186/s13104-016-2167-3

Received: 20 April 2016

Accepted: 16 July 2016

Published: 26 July 2016

Abstract

Background

African elephants comprise two species, the savanna elephant (Loxodonta africana) and the forest elephant (L. cyclotis), which are distinct morphologically and genetically. Forest elephants are seriously threatened by poaching for meat and ivory, and by habitat destruction. However, microsatellite markers have thus far been developed only in African savanna elephants and Asian elephants, Elephas maximus. The application of microsatellite markers across deeply divergent lineages may produce irregular patterns such as large indels or null alleles. Thus we developed novel microsatellite markers using DNA from two African forest elephants.

Findings

One hundred microsatellite loci were identified in next generation shotgun sequences from two African forest elephants, of which 53 were considered suitable for testing. Twenty-three microsatellite markers successfully amplified elephant DNA without amplifying human DNA; these were further characterized in 15 individuals from Lope National Park, Gabon. Three of the markers were monomorphic and four of them carried only two alleles. The remaining sixteen polymorphic loci carried from 3 to 8 alleles, with observed heterozygosity ranging from 0.27 to 0.87, expected heterozygosity from 0.40 to 0.86, and the Shannon diversity index from 0.73 to 1.86. Linkage disequilibrium was not detected between loci, and no locus deviated from Hardy–Weinberg equilibrium.

Conclusions

The markers developed in this study will be useful for genetic analyses of the African forest elephant and contribute to their conservation and management.

Keywords

Conservation geneticsLope National ParkShort tandem repeats

Findings

Among African elephants, genetic studies have established that savanna elephants, Loxodonta africana, and forest elephants, Loxodonta cyclotis, are morphologically distinct [1] and comprise deeply divergent lineages separated by 4–7 million years of evolution (e.g. [2, 3]). Forest elephants have been extirpated or reduced to critically low densities across much of their former range, and they remain under serious threat from poaching for meat and ivory, and from habitat destruction [4]. Microsatellite marker studies have thus far been developed only in African savanna elephants and Asian elephants, Elephas maximus. The application of microsatellite markers across such deeply divergent lineages may produce null alleles or irregular patterns [5]. For example, some microsatellite markers developed in savanna elephants show an allele size range in forest elephants that suggests the presence of large indels [6]. Likewise, of ten microsatellite loci developed in domestic cats (Felis catus) that were later tested in pumas (Puma concolor), six loci showed differences in the structure of repeat units and many alleles reflected size homoplasies [5]. In this study, we developed novel microsatellite markers using DNA from two African forest elephants, and tested and characterized the markers using high quality DNA extracted from tissue samples of 15 forest elephants from Lope National Park, Gabon.

This study was conducted under the University of Illinois Institutional Animal Care, and Use Committee approved protocol number 12040. Samples were collected in full compliance with required Convention on International Trade in Endangered Species of Wild Fauna and Flora and other institutional permits.

DNA was extracted as previously described [7]. Genomic DNA samples from two forest elephants, SL0001 from Sierra Leone (West African Guinean Forest) and LO3502 from Lope National Park, Gabon (Central African Congolian Forest), were sequenced on 1/16th of a PicoTiterPlate (PTP) (1/8 PTP total) on the Roche 454 GS FLX+ platform at the UIUC high-throughput sequencing and genotyping unit. The whole genome sequence data was pooled together and MSATCOMMANDER 1.0.8 [8] was run to identify microsatellite repeat motifs by screening the sequences for di-, tri-, tetra- and penta- nucleotide motifs, with a minimum of 8 repeats each. MSATCOMMANDER interfaces with PRIMER 3 software [9], and was modified to allow a minimum length of 18 bp of flanking DNA between the microsatellite repeat and the primer sequences [10, 11]. Primers were designed to amplify a target region of 150 bp or less, inclusive of the two primer lengths, so that they would be appropriate for use with degraded DNA from dung or from other samples with low quality DNA. Default settings were otherwise used for MSATCOMMANDER [8]: optimal primer length of 20 bp (minimum 18 to the maximum 22 bp), optimal melting temperature of 60 °C (range of 58–62 °C).

To preclude the targeting of repetitive regions, the following steps were taken. First, a blast search was performed using each primer sequence as query against the GS FLX reads, using a Perl script to identify primers that would target repetitive regions. Second, NCBI BLAST (http://www.blast.ncbi.nlm.nih.gov/Blast.cgi) was used to search each sequence of the locus against the savanna elephant (L. africana) nonredundant database. The short tandem repeats of the sequences were masked using RepeatMasker (http://www.repeatmasker.org) before conducting the Blast search. Third, the software In-Silico PCR on the UCSC genome browser (https://www.genome.ucsc.edu/cgi-bin/hgPcr) was used to query oligonucleotide sequences against the human genome (GRCH37/hg19 assembly) to ensure that primers would not target human DNA, since human DNA contamination may be a concern with highly degraded DNA samples. Forest elephant microsatellite loci that were found to be in repetitive regions or to have high similarity to human DNA sequences were removed from further consideration.

In total, 53 of the first 100 microsatellite potential primer pairs identified using MSATCOMMANDER 1.0.8 [8] passed these criteria. These 53 potential primer pairs were each tested with DNA extracted from two African forest elephants, as well as on DNA from two African savanna elephants, with human DNA and water used as controls. At 18 microsatellite loci, alternative primers were subsequently designed and tested in an attempt to reduce artefactual shadow bands or to improve amplification success; while at two loci new primers were designed and tested after the originals were found to amplify human DNA in the negative control. We verified that 23 of 53 microsatellite loci produced amplicons in both elephant species without amplifying human DNA. We characterised these 23 microsatellite loci using the 15 forest elephant samples from Lope National Park, Gabon (Table 1).
Table 1

Characterization of 23 microsatellite markers in 15 forest elephants from Lope National Park, Gabon

Locus

Forward primer sequence (5′–3′)

Reverse primer sequence (5′–3′)

n

No. of alleles

Ho

He

I

Allele size range (bp)

Repeat motif

GenBank accession no.

Lcy-M4

Lcy-M4-F: GGAGAGAGTCTGTGCACCTC

Lcy-M4-R: ATGAGTGTGTGCATGGAACG

15

4

0.27

0.43

0.82

122–128

(AC)8

KU947083

Lcy-M6

Lcy-M6-F: ACGGCAATTTAAGATGGAGCC

Lcy-M6-R: CGGTCATTTGCAACACTGTG

15

5

0.80

0.72

1.33

130–140

(AC)9

KU947085

Lcy-M8

Lcy-M8-F: TTGAAATTCAGATCAGCGTGTG

Lcy-M8-R: CAGGGCTTTAGTTCACGCTC

15

6

0.67

0.72

1.42

125–149

(TG)8

KU947086

Lcy-M16

Lcy-M16-F: CTGATCACTTCTTAGCGGTGTC

Lcy-M16-R: GGTGTTCCTGGACATCTGCC

15

5

0.67

0.69

1.26

133–155

(AC)14

KU947088

Lcy-M17

Lcy-M17-F: GGAGCTCAGGAAATACACAGC

Lcy-M17-R: TGATCGCCTCTGTTTCGTTC

15

4

0.47

0.40

0.73

146–156

(TG)11

KU947089

Lcy-M23

Lcy-M23.2-F: TGAAGGCGTCTCTGTTATTGC

Lcy-M23.2-R: GAAGCCAAGCAAATGGGATA

15

4

0.60

0.46

0.87

160–168

(AC)12

KU947092

Lcy-M24

Lcy-M24.2-F: GATGACTCTGGCTCCTGGAT

Lcy-M24.2-R: CGCCCTGACTGGTCTTACTC

15

5

0.80

0.76

1.43

114–132

(TG)16

KU947093

Lcy-M26

Lcy-M26-F: CAACCAAGTTCTGCCTGCTG

Lcy-M26-R: CGTGGTCTCTTTGCTGTCAC

15

7

0.80

0.86

1.85

148–162

(AC)10

KU947094

Lcy-M27

Lcy-M27.2-F: TCCTTGATGTGGTTTCAGTCA

Lcy-M27.2-R: GGTAGGTTGGCTATGTTTCTTG

15

3

0.53

0.48

0.80

123–131

(AC)9

KU947095

Lcy-M29

Lcy-M29-F: AGCCTCTTTCTTTCCGTTGC

Lcy-M29-R: AGATCCTCAGGGTAATTTGCAC

15

5

0.47

0.67

1.22

160–170

(TG)8

KU947096

Lcy-M30

Lcy-M30-F: CACTACGCCAACAGGTTTCC

Lcy-M30-R: TGTCCCATAGTGTCACCGTG

15

3

0.60

0.52

0.87

150–156

(AC)8

KU947097

Lcy-M40

Lcy-M40-F: TTCAAGTACCTGCTGTCACTG

Lcy-M40-R: TTCTGTCCAAGTAGCTTACCTG

15

3

0.47

0.57

0.88

160–166

(AC)9

KU947099

Lcy-M43

Lcy-M43.2-F: TCCTCACTGCCACAACCAT

Lcy-M43.2-R: GGGTCTCTTCCCATCATCAG

15

8

0.87

0.81

1.83

135–155

(AC)26

KU947101

Lcy-M44

Lcy-M44.2-F: GGCCTGATATAGCCCTTGT

Lcy-M44.2-R: TCCTGCTGTACTTGAATTTCTGA

15

6

0.80

0.77

1.57

128–144

(AC)11

KU947102

Lcy-M45

Lcy-M45.3-F: CAGCTATTCTATCCTCACAAGTCCT

Lcy-M45.3-R: TGTGAATGGAGAGTTTTCTCTGA

15

8

0.87

0.85

1.86

123–147

(AC)18

KU947103

Lcy-M50

Lcy-M50.2-F: CCCAGGACCAGCATAGTGAT

Lcy-M50.2-R: TGGAATAAATCAAGAGTAAGAATTCAC

15

4

0.60

0.56

1.02

137–147

(AG)11

KU947104

Lcy-M15a

Lcy-M15-F: AATCAGGCAGCTAACAACGG

Lcy-M15-R: CAGCCCTTCACAGAAAGTCC

15

2

0.07

0.07

0.15

148–150

(TG)9

KU947087

Lcy-M20a

Lcy-M20.2-F: GTCTTCCAAAGCACCCTCTG

Lcy-M20.2-R: AATAGACGGGAGAGGGGAGT

15

2

0.47

0.36

0.54

156–158

(AC)10

KU947090

Lcy-M22a

Lcy-M22-F: CTTGAGCCTGCTGTATGTGC

Lcy-M22-R: CAGAAGCTGGATGGTCAAGC

15

2

0.13

0.13

0.25

155–157

(TG)10

KU947091

Lcy-M39a

Lcy-M39.2-F: CATGGTGACTGCTGCATTG

Lcy-M39.2-R: TGTTGCTTGTTCTGTCCCTAGA

15

2

0.07

0.28

0.45

157–163

(AGC)10

KU947098

Lcy-M5a

Lcy-M5-F: GTAGTTGCCTCAAGTTCCAGC

Lcy-M5-R: CTCCAACACTCCTCCCTCTG

15

1

0.00

0.00

0.00

121

(AT)10

KU947084

Lcy-M42a

Lcy-M42.2-F: AAGGCATATGCAGGAAGCTG

Lcy-M42.2-R: AACTGTGCTCCAGGGTCACT

14

1

0.00

0.00

0.00

120

(AC)19

KU947100

Lcy-M52a

Lcy-M52-F: CCGTAAGCTAATCCTCCTGC

Lcy-M52-R: ATTTGCCTTTGTTCCTGCCG

15

1

0.00

0.00

0.00

168

(AC)8

KU947105

An M13 forward tail (TGTAAAACGACGGCCAGT) that was at the 5′ end of each forward primer is not shown above

PCR algorithms are detailed in Additional file 1

Allele sizes shown here include both forward and reverse primer lengths including the M13 forward tail length

Ho and He represent observed and expected heterozygosity, respectively, I represents Shannon’s diversity index

aLinkage disequilibrium and deviation from Hardy–Weinberg equilibrium were not examined due to low genetic diversity

All forward primers included the M13 forward sequence (TGTAAAACGACGGCCAGT) at the 5′ end. A FAM- or VIC- fluorescent labeled M13 forward primer was included in the reaction to label the PCR amplicon [12], along with a conventional reverse primer. The PCR mix consisted of 1X PCR buffer II (Life Technologies, Carlsbad, CA, USA), 2 mM MgCl2, 200 μM of each dNTP (Life Technologies) with 0.04 units/μl final concentration of AmpliTaq Gold DNA Polymerase (Life Technologies) along with 1.2 µl of primer mix. A detailed protocol describing the components of the PCR mix is provided in the Additional file 1.

The PCR cycling program for all but one of the primer pairs was designated “touchdown 50” and is described in the Additional file 1. The locus Lcy-M45 produced a high degree of artefactual shadow bands, so the PCR cycling program was modified and the final annealing temperature was kept higher to reduce background noise. This alternative was designated “touchdown 56” and is also detailed in the Additional file 1. PCR amplicons were run on a 2 % agarose gel with ethidium bromide and examined under UV light. The remaining amplicon from two different loci that were labeled with different fluorescent dyes were mixed, then diluted depending on the intensity of the image on the agarose gel photo, followed by analyses on an ABI 3730XL capillary sequencer at the University of Illinois at Urbana-Champaign High-Throughput Sequencing and Genotyping Unit. The software Genemapper Version 3.7 (Life Technologies) was used to call and bin alleles. Genotyping was conducted independently by two individuals to ensure consistency of calls.

MS Tool v3 [13], Arlequin version 3.5.1.3 [14], and GenAlEx 6.5 [15] were used to calculate expected heterozygosity (He) and observed heterozygosity (Ho); the estimates were confirmed as consistent among the software packages. GenAlEx 6.5 [15] was also used to calculate Shannon’s diversity index (I) and to make allele histograms for each locus (Additional file 1). Shannon’s diversity index is used to quantify biological diversity and accounts for both abundance and evenness of the variation present. Shannon’s diversity index uses allele frequencies and quantifies the informativeness of the markers, with higher values for more informative markers, and a value of 0 for monomorphic markers [16]. Microsatellite data were tested for deviation from Hardy–Weinberg equilibrium (HWE) and for linkage disequilibrium (LD) using Genepop 4.2 [17]. A Markov chain algorithm was used to test for HWE using 10,000 dememorization steps, 200 batches and 1000 iterations per batch. LD was tested using 10,000 dememorization steps, 100 batches and 1000 iterations per batch for each pairwise comparison between loci.

The 23 primer pairs successfully amplified microsatellite products in all 15 DNA samples from Lope (Table 1). Microsatellite markers Lcy-M5, Lcy-M42, and Lcy-M52 were monomorphic and Lcy-M15, Lcy-M20, Lcy-M22, and Lcy-M39 carried only two alleles in the Lope samples and were removed from further consideration. At the remaining 16 loci, the number of alleles ranged from 3 to 8 with an average of 5.00 ± 0.41 (SE). The average observed heterozygosity across the 16 loci was 0.64 ± 0.04 (SE), with the highest value being 0.87. The average expected heterozygosity across the 16 loci was 0.63 ± 0.04 (SE), with the highest value being 0.86. The average Shannon diversity index was 1.23 ± 0.10 (SE), with a range from 0.73 to 1.86. There was no significant linkage disequilibrium between markers after Bonferroni correction (p > 0.0004). Among 16 markers, none deviated from HWE after Bonferroni correction (p > 0.003).

Of the 53 novel microsatellite markers developed in forest elephants, 23 loci were tested and characterized. Sixteen of 23 markers displayed more than 2 alleles and are recommended for future use. These microsatellite markers will allow assessment of the genetic diversity and structure of forest elephant populations, which would aid in their conservation and management.

Notes

Abbreviations

He

expected heterozygosity

Ho

observed heterozygosity

HWE: 

Hardy–Weinberg equilibrium

LD: 

linkage disequilibrium

LO: 

Lope National Park, Gabon

PTP: 

picotiterplate

SE: 

standard error

SL: 

Sierra Leone

Declarations

Authors’ contributions

YI, NJG, and ALR conceived and designed the project. NAG and YI conducted experiments and analyses. NJG provided samples. All authors contributed to writing and approved the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We thank K. Zhao and J.R. Brandt for assistance with analyses, and thank the UIUC High-Throughput Sequencing and Genotyping Unit for running the Roche 454 GS FLX+ and ABI 3730XL. We are grateful to the government of Gabon for permission to collect samples, to A. Turkalo, M. Fay, and L. White, and to A. Lécu at Zoo de Vincennes (Paris Zoo) for help in collecting them.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The microsatellite sequences were submitted to NCBI GenBank (KU947083–KU947105). NCBI GenBank numbers are listed in Table 1.

Ethics approval and consent to participate

The study was conducted under the University of Illinois Institutional Animal Care and Use Committee approved protocol number 12040. Samples were imported through a CITES permit.

Funding

The work was funded by USFWS African Elephant Conservation Fund Grant AFE-0778-F12AP01143.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Animal Sciences, University of Illinois at Urbana-Champaign
(2)
Puget Sound Institute, University of Washington
(3)
The Institute for Genomic Biology, University of Illinois at Urbana-Champaign

References

  1. Grubb P, Groves CP, Dudley JP, Shoshani J. Living African elephants belong to two species: Loxodonta africana (Blumenbach, 1797) and Loxodonta cyclotis (Matschie, 1900). Elephant. 2000;2(4):1–4.Google Scholar
  2. Brandt AL, Ishida Y, Georgiadis NJ, Roca AL. Forest elephant mitochondrial genomes reveal that elephantid diversification in Africa tracked climate transitions. Mol Ecol. 2012;21(5):1175–89.View ArticlePubMedGoogle Scholar
  3. Roca AL, Ishida Y, Brandt AL, Benjamin NR, Zhao K, Georgiadis NJ. Elephant natural history: a genomic perspective. Ann Rev Anim Biosci. 2015;3(3):139–67.View ArticleGoogle Scholar
  4. Maisels F, Strindberg S, Blake S, Wittemyer G, Hart J, Williamson EA, Aba’a R, Abitsi G, Ambahe RD, Amsini F, et al. Devastating decline of forest elephants in central Africa. PLoS ONE. 2013;8(3):e59469.View ArticlePubMedPubMed CentralGoogle Scholar
  5. Culver M, Menotti-Raymond MA, O’Brien SJ. Patterns of size homoplasy at 10 microsatellite loci in pumas (Puma concolor). Mol Biol Evol. 2001;18(6):1151–6.View ArticlePubMedGoogle Scholar
  6. Comstock KE, Georgiadis N, Pecon-Slattery J, Roca AL, Ostrander EA, O’Brien SJ, Wasser SK. Patterns of molecular genetic variation among African elephant populations. Mol Ecol. 2002;11(12):2489–98.View ArticlePubMedGoogle Scholar
  7. Roca AL, Georgiadis N, Pecon-Slattery J, O’Brien SJ. Genetic evidence for two species of elephant in Africa. Science. 2001;293(5534):1473–7.View ArticlePubMedGoogle Scholar
  8. Faircloth BC. Msatcommander: detection of microsatellite repeat arrays and automated, locus-specific primer design. Mol Ecol Resour. 2008;8(1):92–4.View ArticlePubMedGoogle Scholar
  9. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000;132:365–86.PubMedGoogle Scholar
  10. Brandt JR, Van Coeverden de Groot PJ, Zhao K, Dyck MG, Boag PT, Roca AL. Development of nineteen polymorphic microsatellite loci in the threatened polar bear (Ursus maritimus) using next generation sequencing. Conserv Genet Resour. 2014;6(1):59–61.View ArticleGoogle Scholar
  11. Ruiz-Rodriguez C, Ishida Y, Greenwood A, Roca A. Development of 14 microsatellite markers in the Queensland koala (Phascolarctos cinereus adustus) using next generation sequencing technology. Conserv Genet Resour. 2014: 1–3.Google Scholar
  12. Boutin-Ganache I, Raposo M, Raymond M, Deschepper CF. M13-tailed primers improve the readability and usability of microsatellite analyses performed with two different allele-sizing methods. Biotechniques. 2001;31(1):24–6.PubMedGoogle Scholar
  13. Parks SDE. Trypanotolerance in West African cattle and the population genetic effects of selection. Ph.D thesis. University of Dublin; 2001.Google Scholar
  14. Excoffier L, Lischer HE. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour. 2010;10(3):564–7.View ArticlePubMedGoogle Scholar
  15. Peakall R, Smouse PE. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research–an update. Bioinformatics. 2012;28(19):2537–9.View ArticlePubMedPubMed CentralGoogle Scholar
  16. Sherwin WB, Jabot F, Rush R, Rossetto M. Measurement of biological information with applications from genes to landscapes. Mol Ecol. 2006;15(10):2857–69.View ArticlePubMedGoogle Scholar
  17. Rousset F. Genepop’007: a complete re-implementation of the genepop software for Windows and Linux. Mol Ecol Resour. 2008;8(1):103–6.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s) 2016

Advertisement