Skip to main content

A new primer pair for barcoding of bees (Hymenoptera: Anthophila) without amplifying the orthologous coxA gene of Wolbachia bacteria

Abstract

Objectives

DNA barcoding became an effective method for the identification and monitoring of bees. However, standard primer pairs used for barcoding often result in (co-) amplification of bacterial endosymbionts of the genus Wolbachia, which are widespread among bee species. Here we designed a new primer pair and compared it with the performance of the standard Folmer-primers for a small sample set of bees representing the main taxonomic groups of bees.

Results

The newly designed primer pair (BeeCox1F1/BeeCox1R2) outperformed the standard barcoding primer (LCO1490/HCO2198). By generating barcodes for a small test set of bees we found that the new primer pair produced high-quality sequences in all cases for unambiguous species identification using BOLD. Conversely, the standard barcoding primers often co-amplified the homologous Wolbachia gene and resulted in mixed chromatogram signals. These sequences showed high similarity with the bacterial endosymbiont instead of the host.

Introduction

More than 20,000 species of bees (Hymenoptera, Anthophila) are estimated to occur worldwide [1] and they became a posterchild for conservation biology as they play a vital role in pollination in both natural and managed ecosystems [2]. Unfortunately, bee diversity and abundance has been reported to decline at different levels across continents [3]. Extensive faunistic inventories are necessary to better understand changes in occurrence of bee species across scales. However, bee taxonomy can be difficult as exhaustive identification keys are available for only some taxonomic groups and few geographic regions. Moreover, sometimes confident identification is possible only in one of the sexes (e.g., Andrena ovatula group), and (nearly) cryptic species complexes have been described in several recent revisions of selected taxa [4]. Different ways to accelerate bee identification and biomonitoring have been suggested [5, 6]. The most prominent approach is DNA barcoding, where a specific segment of the mitochondrial cytochrome c oxidase 1 gene (cox1) is used for species identification [7]. As such, several geographic region specific barcoding initiatives for bees have been launched or already successfully finished, e.g., Central Europe [8], Ireland [9], Canada [10], providing the necessary background for DNA-based identification.

Primarily, the success of DNA barcoding depends on the specificity of the primers to the target organism’s cox1 gene. Intracellular Alphaproteobacteria of the genus Wolbachia have been recorded from (terrestrial) arthropods and selected nematodes [11]. Presence of these bacteria often causes co-amplification of the orthologous coxA gene along with (or instead of) the host cox1 gene. More than 60% of the native German bee species have been reported to be infected by Wolbachia [12, 13]. Several previous studies reported that the standard DNA barcoding primers (e.g., LCO1490 and HCO2198 [14], LepF1 and LeR1 [15]) often resulted in mixed amplicons and poor-quality sequences in bees [9, 16]. Further, screening of the BOLD database revealed the highest number of unintended amplifications of Wolbachia DNA in Hymenoptera [13]. There seem to be taxon-specific patterns regarding the frequency of infected species, and especially a high number of species from the species-rich genera Andrena, Halictus, Lasioglossum, Nomada or Sphecodes are infected [13]. In congruence with the reports by [9], our routine work in the lab showed that individuals of these genera are difficult to barcode using standard approaches, as sequencing revealed mixed signals or the Wolbachia sequence. This comes to no surprise, as the most commonly used standard barcoding primers (LCO1490/HCO2198, LepF1/LepR1) actually show a high similarity to the homologous region of the Wolbachia coxA gene (Fig. 1). Though alternative primer pairs have been already suggested as a workaround, their annealing temperature seems relatively low (and therefore unspecific) [17] or consist of highly degenerative priming sites [16]. These features could hamper the sequencing and result in poor sequences. Here we present a newly designed primer combination and test its suitability for a phylogenetically representative taxon sampling of bees, with a special focus on its suitability in the case of Wolbachia infected species.

Fig. 1
figure1

Multiple sequence alignment. Snap shot of the multiple alignment of bee cox1-sequences (and two sequences of the homologous Wolbachia gene) indicating the position of the forward (a) and reverse (b) primer sequences of the standard (LCO1498/HCO2198, LepF1/LepR1) and new (BeeCox1F1/BeeCox1R2) primer pairs

Main text

Methods

Species collection and DNA extraction

A total of 48 bees, representing 44 species and 18 genera, were collected from sand and gravel pits located in the FFH-protected area “Ballertasche” (51° 27′ 30.3ʺ N 9° 38′ 10.2ʺ E) and the nature-sanctuary “NSG Stadtwald Göttingen und Kerstlingeröder Feld” (51° 32′ 36.1ʺ N 10° 01′ 58.7ʺ E). The specimens were identified based on morphology [18,19,20,21,22,23,24,25] to the genus or species level and later processed for molecular lab work. Thorax muscle tissue was removed using forceps and transferred directly into an Eppendorf cap for DNA extraction using the Qiagen DNEasy Blood and Tissue Kit (Qiagen, Hilden).

Primer design and PCR

Initially, selected bees including difficult to identify groups of species (e.g., females of the Andrena ovatula group) were used for DNA barcoding using the standard Folmer primers (LCO1490/HCO2198). However, in many cases the resultant sequences were either from Wolbachia endosymbionts or had background noise with multiple signals (see below for details on results). Thus, a new set of primers were designed by downloading the complete cox1 sequences (around 1500 bp in length) of phylogenetically representative species of bees (n = 66) and, the orthologous gene region of Wolbachia sp. from the NCBI Genbank.

The sequences were designed using the MAFFT online tool [26] by keeping default parameters and automatic strategy selection for alignment. Further, the traditional barcoding primers used for insects (LCO1490/HCO2198, LepF1/LepR1) were also aligned with the sequences to delimit the barcoding region within the gene. After alignment, the primers were designed in such a way that the reverse primer binding site is divergent from Wolbachia species and cannot amplify the orthologous coxA gene. The alignment including NCBI accession numbers is available at https://github.com/Animal-Evolution-and-Biodiversity/Design_Barcoding_Primer_Bees/tree/main/Alignment.

The newly designed primer pair was named BeeCox1F1 (TAGTCAACAAATCATAAAGATATTGG) and BeeCox1R2 (CCAAATCCTGGTAGAATTAAAATATA). The expected PCR amplicon size is around 670 bp, a bit larger than that of the standard barcoding primer pairs (~ 650 bp). We used the NetPrimer online tool (http://www.premierbiosoft.com/netprimer/) to check the suitability of this primer pair (melting temperature, secondary structures and cross dimers) and validated by amplifying the cox1 gene from the bees that have shown misamplification with the standard primer pairs (Table 1).

Table 1 Species level taxonomic assignment successa of barcodes from different primer pairs of selected bee species representing different families

In this study, we compared the efficiency of the new BeeCox1F1/BeeCox1R2 primer combination with the standard LCO1490/HCO2198 primer. The PCR regime for the new primer, BeeCox1F1/BeeCox1R2 was as follows: Initial denaturation at 94 °C for 2 min; 40 cycles of 30 s at 94 °C, 45 s at 50 °C and 1 min at 72 °C; Final extension for 10 min at 72 °C. For the LCO1490/HCO2198 primer, PCR conditions were as follows: Initial denaturation at 94 °C for 2 min; 40 cycles of 30 s at 94 °C, 45 s at 46 °C and 1 min at 72 °C; Final extension for 10 min at 72 °C. All PCRs were carried out in a total volume of 25 µl, containing 1 µl of each primer (10 pM), 12.5 µl DreamTaq Green PCR Master Mix (Thermo Fisher), 1 µl of genomic DNA and 9.5 µl of ddH2O. Negative controls containing water instead of template DNA were included in all PCRs. Sanger sequencing and basecalling (> QV20 using the KB basecaller v3.1) for forward directions for all fragments was performed by Microsynth Seqlab GmbH (Germany). All chromatograms and base-called fasta-files from Sanger sequencing are available at https://github.com/Animal-Evolution-and-Biodiversity/Design_Barcoding_Primer_Bees/tree/main/Sanger_sequence_files.

Taxonomic assignment

Sequence quality was verified by inspecting the chromatograms using Chromas 2.6.6 (http://technelysium.com.au/wp/chromas/). The sequences were assigned to the species by subjecting them similarity analysis with the BOLD reference database. The similarity value within a range of 98–100% was considered as the threshold value for taxonomic assignment. The results were categorized as (i) unambiguous identification with the barcode sequence, (ii) ambiguous identification showing similarity with Wolbachia CoxA sequence and (iii) no match with reference sequences due to poor sequence quality.

Results and discussion

PCR and sequencing results

We were able to produce PCR amplification products for both primer pairs for all 48 bee individuals included in this study, altogether resulting in 96 PCR products. Our taxon sampling hereby represents six of the seven described families of Anthophila. We focussed on members of Andrenidae and Halictidae, as they had shown before to be more difficult to be barcoded (see above), however for all available bee families we included several representatives to study the performance of the primer pairs. After sequencing, we found 8 sequences with a mixed signal, while 88 sequences could be used for identification using the BOLD database. Sequences with mixed signals were all amplicons from the LCO1490/HCO2198 primer pair, and in four cases stem from individuals belonging to the Andrena ovatula-group.

Taxonomic assignment

Altogether 88 sequences were identified using the BOLD database. None of these sequences showed frame-shifts or stop codons, which suggest that possible NUMTs were not amplified. In the case of 66 barcodes from 33 individuals both primer pairs produced the same result and the corresponding taxonomic assignment of the bee species was unambiguous. In the case of seven individuals, the sequence from the LCO1490/HCO2198 primer pair was taxonomically assigned to originate from a Wolbachia endosymbiont, while the corresponding barcodes from the BeeCox1F1/BeeCox1R2 primer pair allowed an unambiguous taxonomic assignment to a bee species. The same is true for the 8 barcodes which could only be analysed for the BeeCox1F1/BeeCox1R2 primer pair, as the LCO1490/HCO2198 primer pair resulted in a mixed signal of the sequenced barcode.

Conclusion

By comparing the location of the standard barcoding primer pairs in the multiple sequence alignment of complete cox1-sequences of bees and recognizing its similarity with the corresponding Wolbachia gene sequences, we designed a new primer pair circumventing these matches (Fig. 1). We were able to produce PCR amplification products for the new primer pair and the standard Folmer-primers for all 48 bee individuals included in our small test sample set, representing six of the seven higher taxa (“families”) recognized within Anthophila. Even among this small sample size we found seven cases where the Folmer-primers amplified Wolbachia instead of the host cox-1 gene and eight cases of mixed signal, which might also stem from simultaneous amplification of host and endosymbiont DNA. In contrast, with the newly designed BeeCox1F1/ BeeCox1R2-primer pair we were in all cases able to generate clear sequences which could be identified as the corresponding bee species in the BOLD database. As such the newly proposed primer pair should help to reduce problems when barcoding bees, which will be especially important for morphologically difficult to identify species, such as from the Andrena ovatula group.

Limitations

The new barcoding primer pair has been tested for a phylogenetically representative, but small taxon sampling of bees. It is also unclear how they will perform when barcoding related taxa of Hymenoptera. Whereas we are convinced that this barcoding primer pair will circumvent problems related to mis-amplification of endosymbionts of the genus Wolbachia, possible amplification of nuclear integrations of mitochondrial sequences (NUMTs) remains an issue for DNA barcoding [27].

Availability of data and materials

Original chromatograms and sequence data for all barcoded bees in this study, as well as the multiple alignment for primer design can be found at https://github.com/Animal-Evolution-and-Biodiversity/Design_Barcoding_Primer_Bees.

Abbreviations

BOLD:

Barcode of Life Data System

PCR:

Polymerase chain reaction

References

  1. 1.

    Orr MC, Hughes AC, Chesters D, Pickering J, Zhu C-D, Ascher JS. Global patterns and drivers of bee distribution. Curr Biol. 2021;31:451-458.e454.

    CAS  Article  Google Scholar 

  2. 2.

    Kremen C, Williams NM, Aizen MA, Gemmill-Herren B, LeBuhn G, Minckley R, Packer L, Potts SG, Roulston TA, Steffan-Dewenter I, et al. Pollination and other ecosystem services produced by mobile organisms: a conceptual framework for the effects of land-use change. Ecol Lett. 2007;10:299–314.

    Article  Google Scholar 

  3. 3.

    Zattara EE, Aizen MA. Worldwide occurrence records suggest a global decline in bee species richness. One Earth. 2021;4:114–23.

    Article  Google Scholar 

  4. 4.

    Pauly A, Noël G, Sonet G, Notton DG, Boevé J-L. Integrative taxonomy resuscitates two species in the Lasioglossum villosulum complex (Kirby, 1802) (Hymenoptera: Apoidea: Halictidae). Eur J Taxon. 2019. https://doi.org/10.5852/ejt.2019.541.

    Article  Google Scholar 

  5. 5.

    Buschbacher K, Ahrens D, Espeland M, Steinhage V. Image-based species identification of wild bees using convolutional neural networks. Ecol Inform. 2020;55:101017.

    Article  Google Scholar 

  6. 6.

    Godfray HCJ, Knapp S, Gaston KJ, O’Neill MA. Automated species identification: why not? Philos Trans R Soc Lond B Biol Sci. 2004;359:655–67.

    Article  Google Scholar 

  7. 7.

    Hebert PDN, Cywinska A, Ball SL, deWaard JR. Biological identifications through DNA barcodes. Proc R Soc Lond B. 2003;270:313–21.

    CAS  Article  Google Scholar 

  8. 8.

    Schmidt S, Schmid-Egger C, Morinière J, Haszprunar G, Hebert PDN. DNA barcoding largely supports 250 years of classical taxonomy: identifications for Central European bees (Hymenoptera, Apoidea partim). Mol Ecol Resour. 2015;15:985–1000.

    CAS  Article  Google Scholar 

  9. 9.

    Magnacca KN, Brown MJF. DNA barcoding a regional fauna: Irish solitary bees. Mol Ecol Resour. 2012;12:990–8.

    CAS  Article  Google Scholar 

  10. 10.

    Sheffield CS, Heron J, Gibbs J, Onuferko TM, Oram R, Best L, deSilva N, Dumesh S, Pindar A, Rowe G. Contribution of DNA barcoding to the study of the bees (Hymenoptera: Apoidea) of Canada: progress to date. Can Entomol. 2017;149:736–54.

    Article  Google Scholar 

  11. 11.

    Weinert LA, Araujo-Jnr EV, Ahmed MZ, Welch JJ. The incidence of bacterial endosymbionts in terrestrial arthropods. Proc R Soc B Biol Sci. 2015;282:20150249.

    Article  Google Scholar 

  12. 12.

    Gerth M, GeißLer A, Bleidorn C. Wolbachia infections in bees (Anthophila) and possible implications for DNA barcoding. Syst Biodivers. 2011;9:319–27.

    Article  Google Scholar 

  13. 13.

    Gerth M, Saeed A, White JA, Bleidorn C. Extensive screen for bacterial endosymbionts reveals taxon-specific distribution patterns among bees (Hymenoptera, Anthophila). FEMS Microbiol Ecol. 2015;91:fiv047.

    Article  Google Scholar 

  14. 14.

    Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek RC. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol. 1994;3:294–9.

    CAS  PubMed  Google Scholar 

  15. 15.

    Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W. Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proc Natl Acad Sci USA. 2004;101:14812–7.

    CAS  Article  Google Scholar 

  16. 16.

    Villalta I, Ledet R, Baude M, Genoud D, Bouget C, Cornillon M, Moreau S, Courtial B, Lopez-Vaamonde C. A DNA barcode-based survey of wild urban bees in the Loire Valley, France. Sci Rep. 2021;11:4770.

    CAS  Article  Google Scholar 

  17. 17.

    Françoso E, Arias MC. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode. Mol Ecol Resour. 2013;13:844–50.

    Article  Google Scholar 

  18. 18.

    Scheuchl E. Illustrierte Bestimmungstabellen der Wildbienen Deutschlands und Österreichs. Band I: Anthophoridae. Velden: Eigenverlag; 1995.

    Google Scholar 

  19. 19.

    Scheuchl E. Illustrierte Bestimmungsschl€ussel der Wildbienen Deutschlands und Österreichs. Band II: Megachilidae - Melittidae. Velden: Eigenverlag; 2006.

    Google Scholar 

  20. 20.

    Schmid-Egger C, Scheuchl E. Illustrierte Bestimmungsschl€ussel der Wildbienen Deutschlands und Österreichs. Band III: Andrenidae. Velden: Eigenverlag; 1997.

    Google Scholar 

  21. 21.

    Amiet F. Hymenoptera Apidae, 1. Teil. Allgemeiner Teil, Gattungsschlüssel, Die Gattungen Apis, Bombus und Psithyrus. 1996.

  22. 22.

    Amiet F, Neumayer R, Müller A. Apidae 2. Colletes, Dufourea, Hylaeus, Nomia, Nomioides, Rhophitoides, Rophites, Sphecodes, Systropha. 1999.

  23. 23.

    Amiet F, Hermann M, Müller A, Neumayer R. Apidae 3. Halictus, Lasioglossum. 2001.

  24. 24.

    Bogusch P, Straka J. Review and identification of the cuckoo bees of central Europe (Hymenoptera: Halictidae: Sphecodes). Zootaxa. 2012;3311:1–41.

    Article  Google Scholar 

  25. 25.

    Straka J, Bogusch P. Contribution to the taxonomy of the Hylaeus gibbus species group in Europe (Hymenoptera, Apoidea and Colletidae). Zootaxa. 2011;2932:51–67.

    Article  Google Scholar 

  26. 26.

    Katoh K, Rozewicki J, Yamada KD. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform. 2017;20:1160–6.

    Article  Google Scholar 

  27. 27.

    Song H, Buhay JE, Whiting MF, Crandall KA. Many species in one: DNA barcoding overestimates the number of species when nuclear mitochondrial pseudogenes are coamplified. Proc Natl Acad Sci. 2008;105:13486–91.

    CAS  Article  Google Scholar 

Download references

Acknowledgements

We would like to thank B. Preuschhof from the “Team Natur- und Bodenschutz” of the Landkreis Göttingen and M. Weitemeier from the Untere Naturschutzbehörde of the City of Göttingen for issuing permits to sample wild bees in protected areas.

Funding

Open Access funding enabled and organized by Projekt DEAL.

Author information

Affiliations

Authors

Contributions

CB carried out study design, sampling of specimens and data analyses. KH performed all molecular laboratory work. Both authors read and approved the final manuscript.

Corresponding author

Correspondence to Christoph Bleidorn.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Bleidorn, C., Henze, K. A new primer pair for barcoding of bees (Hymenoptera: Anthophila) without amplifying the orthologous coxA gene of Wolbachia bacteria. BMC Res Notes 14, 427 (2021). https://doi.org/10.1186/s13104-021-05845-9

Download citation

Keywords

  • Apoidea
  • Biomonitoring
  • DNA barcoding
  • Misamplification