Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Research Notes

Open Access

Characterization of microsatellite markers developed from Prosopis rubriflora and Prosopis ruscifolia (Leguminosae - Mimosoideae), legume species that are used as models for genetic diversity studies in Chaquenian areas under anthropization in South America

  • Fábio M Alves1, 2,
  • Maria I Zucchi3,
  • Ana MG Azevedo-Tozzi1,
  • Ângela LB Sartori4 and
  • Anete P Souza1, 2Email author
BMC Research Notes20147:375

https://doi.org/10.1186/1756-0500-7-375

Received: 9 January 2014

Accepted: 12 June 2014

Published: 18 June 2014

Abstract

Background

Prosopis rubriflora and Prosopis ruscifolia are important species in the Chaquenian regions of Brazil. Because of the restriction and frequency of their physiognomy, they are excellent models for conservation genetics studies. The use of microsatellite markers (Simple Sequence Repeats, SSRs) has become increasingly important in recent years and has proven to be a powerful tool for both ecological and molecular studies.

Findings

In this study, we present the development and characterization of 10 new markers for P. rubriflora and 13 new markers for P. ruscifolia. The genotyping was performed using 40 P. rubriflora samples and 48 P. ruscifolia samples from the Chaquenian remnants in Brazil. The polymorphism information content (PIC) of the P. rubriflora markers ranged from 0.073 to 0.791, and no null alleles or deviation from Hardy-Weinberg equilibrium (HW) were detected. The PIC values for the P. ruscifolia markers ranged from 0.289 to 0.883, but a departure from HW and null alleles were detected for certain loci; however, this departure may have resulted from anthropic activities, such as the presence of livestock, which is very common in the remnant areas.

Conclusions

In this study, we describe novel SSR polymorphic markers that may be helpful in future genetic studies of P. rubriflora and P. ruscifolia.

Keywords

Prosopis PantanalChacoPopulation GeneticsConservationShort Tandem Repeats

Findings

Background

The genus Prosopis L. belongs to the Leguminosae botanical family, which contains 44 species. Prosopis L. is predominantly restricted to the neotropics [1]. Prosopis rubriflora[2] and Prosopis ruscifolia[3] are tree species known locally as “espinheiro” and “algarroba,” respectively. These species are important both economically and ecologically. For example, the fruits and seeds of P. ruscifolia are reported to be good sources of nutrition for humans and animals [4], and the flowers of P. rubriflora, which are present throughout the year, provide important food resources, such as pollen and nectar, for the local fauna [5]. P. rubriflora has a narrow distribution range and is limited to Paraguay and Brazil, but P. ruscifolia is also found in Argentina and Bolivia [6, 7].

In Brazil, P. rubriflora and P. ruscifolia are associated with Chaquenian areas [8] and are limited to the southern portion of the Pantanal [9, 10]. Both species are excellent indicators of Chaquenian areas in Brazil; P. rubriflora is usually associated with arboreal physiognomy, and P. ruscifolia is frequently associated with forest physiognomy. Both species can be used as models for genetic studies of diversity in these areas.

While estimating genetic diversity, the use of molecular markers has been helpful in defining alleles and studying genetic flow, population structure, paternity, inheritability, genetic maps and conservation genetics [11]. Simple sequence repeat markers (SSRs), commonly referred to as microsatellite markers, are desirable tools because they are co-dominant in nature, multi-allelic and widely distributed in the genome; they are also currently cheap, reproducible and relatively easy to analyze [12]. This work reports the development, characterization and transferability of microsatellite markers for P. rubriflora and P. ruscifolia.

Construction of a microsatellite-enriched library

DNA was extracted from P. rubriflora and P. ruscifolia using the DNeasy® Plant Mini Kit (Qiagen, Hilden, DE) according to the manufacturer’s instructions. Microsatellite-enriched libraries for P. rubriflora and P. ruscifolia were constructed as described by Billote et al.[13]. The genomic DNA was digested with Afa I after enrichment with streptavidin-coated magnetic beads (Streptavidin MagneSphere Paramagnetic Particles, Promega, Madison, WI); biotinylated (CT)8 and (GT)8 microsatellite probes were added for the dinucleotide-enriched library. The fragments were amplified by PCR and cloned into the pGEM-T vector (Promega, Madison, WI). XL1-Blue (Escherichia coli) competent cells were transformed with the recombinant plasmids and then cultivated on agar medium containing ampicillin (100 mg/ml), X-galactosidase 2% (100 μg/ml) and IPTG (100 mM). The selected clones were added to a Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) and sequenced using an ABI 377 sequencer (Applied Biosystems, Foster City, CA). The sequences were aligned and edited using SeqMan Software (DNAStar, Madison, WI), and the adapters and restriction sites were removed using Microsat Software (A. M. Risterucci, CIRAD, personal communication). To identify microsatellite-enriched regions, we used the Simple Sequence Repeat Identification Tool (SSRIT) [14] and defined the following numbers of repeats/motifs: five/dinucleotides, four/trinucleotides and three/tetra- or pentanucleotides. After these steps, primers were designed using the PrimerSelect software (DNAStar, Madison, WI).

Fragment amplification

The fragments were amplified using polymerase chain reactions containing 8 ng of template DNA, 2 mM MgCl2, 50 mM KCl, 20 mM Tris–HCl (pH 8.4), 0.2 mM dNTPs, 0.19 mg/ml BSA (bovine serum albumin), 0.15 mM of each primer and 1 U of Taq DNA polymerase; the reactions were then brought to a final volume of 20 μl with ultrapure water. To define the temperatures for the PCR reactions, we adopted the guidelines described by Mottura et al.[15]; for the annealing temperatures, we used a gradient program with temperatures ranging from 65°C to 55°C. The samples were collected in the Chaco remnants of Corumbá and Porto Murtinho, Mato Grosso do Sul, Brazil. Twenty P. rubriflora samples were collected in each of two Chaco remnant locations: Fazenda São Manoel (FSM) (21°47′44.5″S; 57°39′34.6″W) and Fazenda Santa Vergínia (FSV) (22°06′40.5″S; 57°49′57.6″W). Twenty-three P. ruscifolia samples were collected in Estação do Carandazal (ECD) (19°48′33.2″S; 57°10′11.0″W), and 25 samples were collected in Fazenda Retiro Conceição (FRC) (21°42′23.7″S; 57°45′58.2″W). The cross-amplification of the markers was evaluated in 5 P. rubriflora samples obtained from FRC (21°41′00.7″S; 57°46′43.8″W) and 5 P. ruscifolia samples from Chácara Jacaré (21°41′20.1″S; 57°52′15.5″W) using the same conditions as for the native species. The amplified samples were genotyped by vertical electrophoresis using denaturating polyacrylamide gels (6%), and DNA bands were visualized using silver nitrate [16]; the sizes of the resulting fragments were estimated by comparison to a 10-bp DNA ladder (Invitrogen, Carlsbad, CA). Statistical analyses were performed using Microsatellite Toolkit v.3.1.1 [17] to calculate the expected heterozygosity (He), observed heterozygosity (Ho) and polymorphism information content (PIC). The Genepop software v.1.2 [18] was used to estimate adherence to Hardy-Weinberg (HW) equilibrium and possible linkage disequilibrium (LD), and the frequency of null alleles was estimated using FreeNA [19].

Results and discussion

We designed 32 primer pairs: 13 for P. rubriflora and 19 for P. ruscifolia. However, only 10 of the P. rubriflora primer pairs and 13 of the P. ruscifolia primer pairs amplified properly. The nine remaining pairs of primers were discarded because amplification errors were observed in the preliminary tests. Polymorphisms were detected in 9 of the native P. rubriflora markers and 12 of the native P. ruscifolia markers; only one marker from each species had a monomorphic pattern based on the populations analyzed. Eight markers from P. rubriflora successfully cross-amplified and were polymorphic for the tested samples, and 2 markers failed during cross-amplification. Eleven P. ruscifolia markers were successfully cross-amplified; 7 were polymorphic, and 2 failed this analysis (Table 1).
Table 1

Primers developed for Prosopis rubriflora and Prosopis ruscifolia

Marker

GenBank register no.

Primer sequences (5′-3′)

Motifs

Ta(°C)

Sizea(bp)

Crossed amplification

Prb1

KF923365

F: AACTACCGCAGCACTTTTCAGA

(gt)7

62.7

255-267

267b

R: ACTACTTGGAGATGCCGTGGA

Prb2

KF923366

F: GAAAGCCGCGCTCCTAAG

(gc)4(ac)7

61.0

140-146

126b

R: ATTCTTTTGTGTCTTGTCTTCTCG

Prb3

KF923367

F: TCCAAAGACCGCAAGAAGAT

(ca)7

61.0

149-159

145b

R: AGGCCAAAAAGGACTCAAAAT

Prb4

KF923368

F: ATCCGATAAATACACCTTCTGG

(ca)8

61.0

194-230

203b

R: GGTGTATCGTAAAAGCCTGG

Prb5

KF923369

F: TTTAAACATTGCACGTGAACCTAT

(ac)9

56.4

149-155

-

R: TTCACCCCTAAACCCCCTT

Prb6

KF923370

F: TCATCTCTCAAAGAAAACGCACTC

(tg)10

56.4

115-133

125b

R: CCGCAGAGAAGCCCCTACATA

Prb7

KF923371

F: GGCTTAGCATCACCCTCCAT

(ac)8

61.0

219-225

220b

R: CTTACCCTTTCAGTCCATTTACCA

Prb8

KF923372

F: CAACACCAAAACGGCGAGATGAT

(gt)13

61.0

144-164

154b

R: TTCGCCAAACGCCAGCATTAG

Prb9

KF923373

F: TTCTTCTCCTTCTTCATCTTCCTCC

(ac)9

62.7

167-175

190b

R: ACAACGTTGATCCCAAAACCTAAG

Prb10

KF923374

F: TTTTGGTGGATTTGATAGAGCC

(tca)5

56.4

223

-

R: GAGTGGGGTCAAGAAAGAACAG

Prsc1

KC753210

F: AATGGAGTTTGTTTGTGTCTGTGG

(ac)9(ct)5

56.5

279-297

300b

R: ATTACGGATACATCGAGCCTTCTT

Prsc2

KC753211

F: GCGGAATTCCAAACGACAA

(ac)9

64.7

224-252

250b

R: ACAGCAACACCCTCACTCTCAA

Prsc3

KC753212

F: CCACAAGCACACGCACACTCAGAC

(ca)6

64.7

156-160

122

R: CCAGCACTAGACTTCGCCACCAAC

Prsc4

KC753213

F: CAAAATCCAACAAATAAACACACC

(caa)2(ga)4

63.9

218-232

230b

R: GGCGGATTCTTGGCTCTCT

Prsc5

KC753214

F: CGCGTTAAGTCTGCCTTGCTTT

(gt)8

59.0

220-240

218

R: CTCATGGTATTTCCCTTGTCGTCC

Prsc6

KC753215

F: CGAGCGGCGAAAAATGATAAA

(gt)8

63.9

184-210

200

R: GCTGCTTCCCATAATCCTCTCCT

Prsc7

KC753216

F: CAGGGATTTAATCTCTTTGGTGTAG

(tg)8…(gtgg)2(gt)5

59.0

122-156

122b

R: ACAAGCTGGAAAGAGTCGCA

Prsc8

KC753217

F: AGTGACGTGAACACGCTGAGG

(tg)10

62.7

98-120

114b

R: TGCTGATGTGTGTGGTTTTGAGAT

Prsc9

KC753218

F: TCAGACTCCCGTGAACCAG

(tg)9

59.0

112-122

-

R: CGCACTCGAGCAGCATCT

Prsc10

KC753219

F: AACGCAACGGCCGCAACTAT

(ca)7(ct)7

56.5

260-284

-

R: ACAAAACGCTCGAATACTGGGGG

Prsc11

KC753220

F: CCCGGCAACTCAAATCAACTTCATA

(ac)11

62.7

229-371

244b

R: GGTCTAATTCTATTGGTGGGCTCTCTGG

Prsc12

KC753221

F: GGGGTGCATGTTGGGGATTG

(gt)10

59.0

185-223

220b

R: TTTGGCCGGATTAAAACAGAGCA

Prsc13

KC753222

F: CTTCACCATCACCGATTTCCCTT

(ctt)5

62.7

102

116

  

R: GCAACGAAGCAGCTGAAGAACAC

    

Ta - Optimal annealing temperature defined after gradient tests of the corresponding markers. aRange of the fragment sizes from the polymorphic markers and the sequenced size of the monomorphic markers; bPolymorphism observed for the transferred markers based on the 5 samples used.

The number of P. rubriflora alleles in the sampled remnants ranged from 3 to 12; the polymorphism information content (PIC) values of these markers ranged from 0.073 to 0.791, the observed heterozygosity (Ho) ranged from 0.000 to 0.850, and the expected heterozygosity (He) ranged from 0.000 to 0.835. No evidence of null alleles was observed, and no departure from Hardy-Weinberg equilibrium was observed (Table 2). No significant linkage disequilibrium (LD) was observed for any of the markers of this species after Bonferroni correction (P-value for 5% = 0.001389). The number of P. ruscifolia alleles in both of the remnants ranged from 3 to 17, the PIC values ranged from 0.289 to 0.883, the Ho values ranged from 0.040 to 0.783, and the He values ranged from 0.275 to 0.884. Possible null alleles were observed for the markers Prsc5, Prsc8 and Prsc9 from one remnant (ECD), and the markers Prsc4 and Prsc10 had possible null alleles in both remnants. A departure from HW was observed for Prsc2, Prsc5, Prsc6, Prsc8, Prsc9 and Prsc11 in one of the remnants (the majority were observed in ECD) and for Prsc4, Prsc7 and Prsc10 in both remnants (Table 3). Significant LD was observed for the loci Prsc5 and Prsc6 after Bonferroni correction (P-value for 1% = 0.00016).
Table 2

Markers developed for Prosopis rubriflora

Marker

Na

Ho

He

PIC

Null alleles

HW ( P-value)

T

FSM

FSV

FSM

FSV

FSM

FSV

FSM

FSV

FSM

FSV

Prb1

7

6

7

0.526a

0.474

0.522a

0.737

0.602

0.044

0.145

0.348

0.045

Prb2

3

1

3

0.000

0.150a

0.000

0.145a

0.073

0.001

0.000

-

1.000

Prb3

3

3

2

0.316

0.150

0.428

0.296

0.313

0.103

0.134

0.101

0.069

Prb4

12

11

8

0.650

0.850a

0.799

0.803a

0.766

0.092

0.000

0.457

0.291

Prb5

4

4

4

0.500

0.600

0.583

0.683

0.576

0.039

0.007

0.689

0.254

Prb6

6

4

6

0.500a

0.400

0.458a

0.432

0.413

0.000

0.000

1.000

0.335

Prb7

4

4

4

0.684a

0.650a

0.605a

0.499a

0.473

0.000

0.000

0.355

0.121

Prb8

5

5

3

0.500

0.250

0.524

0.304

0.370

0.000

0.050

0.821

0.468

Prb9

10

10

9

0.684

0.650

0.835

0.819

0.791

0.053

0.062

0.177

0.016

FSM - Fazenda São Manoel, FSV - Fazenda Santa Vergínia, Na - Number of alleles, Ho - Observed heterozygosity, He - Expected heterozygosity, PIC - Polymorphism information content, P-values of Hardy-Weinberg (HW) equilibrium (P-value > 0.0055 after Bonferroni correction), null alleles (null frequency < 0.20). aPopulations where the values of Ho were higher than those of He.

Table 3

Markers developed for Prosopis ruscifolia

Marker

Na

Ho

He

PIC

Null alleles

HW ( P-value)

T

FRC

ECD

FRC

ECD

FRC

ECD

FRC

ECD

FRC

ECD

Prsc1

7

4

7

0.600a

0.783

0.566a

0.828

0.701

0.000

0.020

0.916

0.009

Prsc2

8

7

5

0.480

0.565

0.553

0.761

0.658

0.032

0.114

0.034

0.00c

Prsc3

3

3

3

0.360a

0.348

0.344a

0.456

0.348

0.000

0.048

0.674

0.073

Prsc4

5

4

3

0.040

0.043

0.321

0.275

0.289

0.247b

0.221b

0.000c

0.000c

Prsc5

6

4

5

0.440a

0.273

0.378a

0.654

0.484

0.000

0.218b

1.000

0,000c

Prsc6

8

4

8

0.320

0.696

0.653

0.801

0.703

0.196

0.068

0.001c

0.087

Prsc7

9

6

7

0.440

0.565

0.727

0.779

0.755

0.167

0.081

0.001c

0.000c

Prsc8

7

4

7

0.320

0.174

0.577

0.789

0.656

0.165

0.338b

0.008

0.000c

Prsc9

5

3

3

0.240

0.130

0.280

0.559

0.430

0.040

0.267b

0.484

0.000c

Prsc10

7

5

5

0.286

0.227

0.633

0.758

0.670

0.212b

0.294b

0.000c

0.000c

Prsc11

17

8

12

0.560

0.652

0.845

0.884

0.883

0.157

0.127

0.003

0.000c

Prsc12

5

4

5

0.600

0.591

0.569

0.707

0.589

0.000

0.075

0.592

0.013

FRC - Fazenda Retiro Conceição, ECD - Estação do Carandazal, Na - Number of alleles, Ho - Observed heterozygosity, He - Expected heterozygosity, PIC - Polymorphism information content, P-values of Hardy-Weinberg (HW) equilibrium (P-value > 0.0041 after Bonferroni correction). aPopulations where the values of Ho were higher than those of He; bPossible null alleles (null frequency < 0.20); cDeparture from HW equilibrium was observed.

Higher values of Ho were observed for the Prb1, Prb2, Prb4, Prb6, Prb7, Prsc1, Prsc3 and Prsc5 markers in this study; these higher values may indicate that an insufficient number of samples was collected or may be related to the reproductive patterns of these populations. The ECD populations are highly disturbed, and the FRC population is currently recovering from a relatively recent suppression (within the last 15 years); these factors may underlie the observed departure from HW and the presence of null alleles. A study with new and conserved populations may produce better results for these markers.

These markers are the first microsatellite markers developed for Prosopis rubriflora and Prosopis ruscifolia, and together with the set of P. ruscifolia markers amplified by Bessega et al.[20], they are expected to be useful tools for studies of the conservation genetics, reproductive biology, phylogeography and taxonomy of these species.

Availability of supporting data

The original sequences of the developed markers were submitted to the GenBank database (http://ncbi.nlm.nih.gov), and the registered codes are available in Table 1.

The testimony samples were deposited at Herbarium Universidade Estadual de Campinas (UEC – Campinas, SP, BR) and registered according to the following: P. rubriflora – 74477 (Fazenda São Manoel – Porto Murtinho, MS), 154715 (Fazenda Santa Vergínia – Porto Murtinho, MS); P. ruscifolia – 74469 (Fazenda Retiro Conceição – Porto Murtinho, MS), 37266 (Estação do Carandazal – Corumbá, MS).

Declarations

Acknowledgments

This work received financial support from Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP, proc. 2010/51242-6) as a graduate fellowship to FMA, Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) as a Research fellowship to APS, and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – CAPES/CNPq (Casadinho/Procad # 552352/2011-0).

Authors’ Affiliations

(1)
Departamento de Biologia Vegetal (BV), Instituto de Biologia, Universidade Estadual de Campinas - UNICAMP, Cidade Universitária Zeferino Vaz
(2)
Centro de Biologia Molecular e Engenharia Genética (CBMEG), Universidade Estadual de Campinas - UNICAMP, Cidade Universitária Zeferino Vaz
(3)
Pólo Apta Centro Sul
(4)
Departamento de Biologia, Centro de Ciências Biológicas e da Saúde (CCBS), Universidade Federal de Mato Grosso do Sul – UFMS

References

  1. Lewis GP, Schrire B, Mackinder B, Lock M: Legumes of the World. 2005, Kew: Royal Botanic GardensGoogle Scholar
  2. Hassler E: Repert Spec Nov Regni Veg. 1910, 8: 552.Google Scholar
  3. Grisebach A: Plantae Lorentzianae. Abh Kön Ges Wiss Göttingen. 1874, 19: 130.Google Scholar
  4. Freyre M, Astrada E, Blasco C, Baigorria C, Rozycki V, Bernardi C: Valores nutricionales de frutos de vinal (Prosopis ruscifolia): consumo animal e humano. Ciência y Tecnologia Alimentaria. 2003, 4 (1): 41-46. 10.1080/11358120309487617.View ArticleGoogle Scholar
  5. Freitas TG, Souza CS, Aoki C, Arakaki LMM, Stefanello TH, Sartori ALB, Sigrist MR: Flora of Brazilian humid Chaco: composition and reproductive phenology. Check List. 2013, 9 (5): 973-979.Google Scholar
  6. Burkart AA: A monograph of the genus Prosopis (Leguminosae Subfam. Mimosoideae). J Arnold Arbore. 1976, 57: 219-247.Google Scholar
  7. Prado DE, Gibbs PE, Pott A, Pott VJ: The Chaco-Pantanal transition in southern Mato Grosso, Brazil. Nature and Dynamics of Forest-Savanna Boundaries. Edited by: Furley PA, Proctor J, Ratter JA. 1992, London: Chapman and Hall, 451-470.Google Scholar
  8. Pott A, Pott VJ: Plantas do Pantanal. 1994, Corumbá: EMBRAPAGoogle Scholar
  9. Furtado PP, Guimarães JG, Fonzar BC: Vegetação - As regiões fitoecológicas, sua natureza e seus recursos econômicos. Projeto RADAMBRASIL. Folha SF 21. Campo Grande; geologia, geomorfologia, pedologia, vegetação e uso potencial da terra. Volume 28. Edited by: Divisão de Publicação. 1982, Rio de Janeiro: MME/SG/Projeto RADAMBRASIL, 281-336.Google Scholar
  10. Loureiro RL, Lima JPS, Fonzar BC: Vegetação - As regiões fitoecológicas, sua natureza e seus recursos econômicos. Projeto RADAMBRASIL. Folha SE 21. Corumbá e parte da folha SE.20; geologia, geomorfologia, pedologia, vegetação e uso potencial da terra. Volume 27. Edited by: Divisão de Publicação. 1982, Rio de Janeiro: MME/SG/Projeto RADAMBRASIL, 329-366.Google Scholar
  11. Conner JK, Hartl DL: A Primer of Ecological Genetics. 2004, Massachusetts: Sinauer AssociatesGoogle Scholar
  12. Ferreira ME, Grattapaglia D: Introdução ao uso de marcadores moleculares em análise genética. 1998, Brasília: Embrapa Recursos Genéticos e BiotecnologiaGoogle Scholar
  13. Billotte N, Lagoda PJL, Risterucci AM, Baurens FC: Microsatellite-enriched libraries: applied methodology for the development of SSR markers in tropical crops. Fruits. 1999, 54 (4): 277-288.Google Scholar
  14. Temnykh S, DeClerck G, Lukashova A, Lipovich L: Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential. Genome Res. 2001, 11: 1441-1452. 10.1101/gr.184001.PubMedPubMed CentralView ArticleGoogle Scholar
  15. Mottura MC, Finkeldey R, Verga AR, Gailing O: Development and characterization of microsatellite markers for Prosopis chilensis and Prosopis flexuosa and cross-species amplification. Mol Ecol Notes. 2005, 5: 487-489. 10.1111/j.1471-8286.2005.00965.x.View ArticleGoogle Scholar
  16. Creste S, Tulmann-Neto A, Figueira A: Detection of single repeat polymorphisms in denaturing polyacrilamide sequencing gels by silver staining. Plant Mol Biol Report. 2001, 19: 229-306.View ArticleGoogle Scholar
  17. Park SDE: Trypanotolerance in West African Cattle and the Population Genetic Effects of Selection. PhD thesis. University of Dublin, Ireland; 2001Google Scholar
  18. Raymond M, Rousset F: GENEPOP (Version 1.2): Population Genetics Software for Exact Tests and Ecumenicism. J Hered. 1995, 86 (3): 248-249.Google Scholar
  19. Chapuis MP, Estoup A: Microsatellite null alleles and estimation of population differentiation. Mol Biol Evol. 2007, 24 (3): 621-631.PubMedView ArticleGoogle Scholar
  20. Bessega CF, Pometti CL, Miller JT, Watts R, Saidman BO, Vilardi JC: New microsatellite loci for Prosopis alba and P. chilensis (Fabaceae). Appl Plant Sci. 2013, 1 (5): 1200324.Google Scholar

Copyright

© Alves et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement