Introduction

In recent years, the number of recombinant proteins used for therapeutic applications has increased dramatically. Stable human cell lines have been extensively used as a preferred expression system for recombinant proteins because their biochemical machineries are capable of carrying out most of the post-translational folding and processing required for generating functional and mature protein and provide high protein productivity[1]. While traditional stable transfection strategies typically involve the random integration of foreign genes into chromosomes, it is difficult to obtain homogenous level of protein expression among individual transfected cells, and the gene amplification process results in large genomic rearrangements that lead to further heterogeneity in protein expression levels. Furthermore, the production cell line development process typically requires 6 to 12 months[2]. Site specific integration of protein expressing genes offers an alternative strategy to develop high producing and stable clones in a predictable manner[3]. This greatly improves the recombination efficiency through the use of recombinases, in contrast to the traditional homologous recombination.

Adeno-associated virus (AAV) is the only known eukaryotic virus which has the capability of undergoing site-specific integration into the human genome. Wild-type (wt) viral DNA recombines at chromosome (ch) -19.13.3 qter at a frequency of 70%[4, 5]. Some elements have been involved in site-specific integration: the AAV Rep68/78 protein in trans as recombinase[6], and the AAV inverted terminal repeat (ITR) in cis (this may not be essential if the P5 promoter, which contains a Rep-binding site [RBS], is present), and AAVS1, a unique sequence in the human genome[5, 7–9]. Rep-dependent integration of ITR-flanked cassettes has been reported in human primary cells and human cell lines. The majority of integrations were site specific and occurred within a 1000-bp region of AAVS1[10].

Hemophilia A or factor VIII deficiency is a common X-linked genetic bleeding disorder in humans, occurring in about 10-20 males per million[11]. Recombinant FVIII (rhFVIII) products have been available for 20 years; so far, all are produced in non-human cell lines, which produce recombinant proteins with a non-human pattern of post-translational modifications (PTMs)[12]. Recently, human cell lines have been used to produce rhFVIII and represent an improvement in the category of rhFVIII production[12–15]. Both the avoidance of non-human glycan structures and the achievement of complete sulfation are proposed to lessen the intrinsic immunogenicity of human-derived rhFVIII compared with current rFVIII products.

In this study, we have constructed two plasmids. One plasmid, pSVAV2, contains the AAV rep gene expressing Rep protein which functions as integrase; another plasmid, pTRP5GFPFVIII-BDD, contains B-domain-deleted FVIII (FVIII-BDD) and GFP gene flanked by AAV ITRs. AAV ITRs contains cis elements recognized by Rep protein and guides the site specific integration event. Human embryonic kidney (HEK) 293 cells were co-transfected with the two plasmids and resulted cells were screened by green fluorescence to establish the recombinant FVIII-BDD cell line. The cell line produced active FVIII-BDD that was secreted into the cultured media. The cell line development process took 3 months.

Construction of the recombinant cell line

Standard procedures were followed for plasmid construction, growth, and purification. The plasmid pZp9FVIII△BS containing the B-domain deleted FVIII-BDD cDNA was used as the template for polymerase chain reaction (PCR) (a gift from Prof. Cheng-Wu Chi, Shanghai Institute of Biochemistry, Academia Sinica, Shanghai, China). pTRP5GDNFGFP and pSVAV2 were kindly provided by Dr. Berns, University of Florida, US. The GDNF gene of the plasmid pTRP5GDNFGFP was replaced with FVIII-BDD gene and the resultant plasmid was named as pTRP5GFPFVIII-BDD.

The human embryonic kidney 293 cell line was obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Monolayer cultures of HEK 293 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Hyclone, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and 1% penicillin and streptomycin (Beyotime, China). HEK 293 cells (1 × 10⁵) were seeded in 24-well plates and co-transfected with pTRP5GFPFVIII-BDD and pSVAV2 at ratio of 50: 1 using Polyethylenimine (PEI) according to the manufacturer’s instructions. 25 kDa linear PEI, were purchased from Polyscience (Warrington, PA), and used to prepare a stock 50 mM solution. Then we set up two tubes with either 1 μL of pTRP5GFPFVIII-BDD and 20 ng of pSVAV2, or 0.9 μL of PEI, added 50 μL of HBS (20 mM Hepes buffer, pH 7.4, 150 mM NaCl) to each and incubated them at room temperature for 10 min. The two dilutions were then mixed together and incubated at room temperature for an additional 10 min to allow the formation of PEI-DNA complexes. The reaction mixture was added to the monolayers. After 3 days of transfection, cells were subcultured twice by diluting 1:3. Cells were cloned as follows: cells were plated at 10 cells per well into 96-well plates. Two weeks later, wells containing cells expressing green fluorescence were identified and expanded into a 24-well plate, grown for 5 days, and subsequently cloned into 96-well plate at one cell per well, and the above process was repeated. The single cell cloned fluorescence-positive cell clones were enlarged. The percentage of GFP-positive cells of a selected clone was examined by flow cytometric analysis (FACS, BD LSRFortessa™).

PCR analysis of the site-specific integration of FVIII-BDD gene

Total genomic DNA was isolated from GFP expression HEK 293 cells. The transgenes were examined by PCR performed with FVIII primers (sense primer: 5′-CATCGCTAGCGCCACCATGCAAATAGAGCTC, anti-sense primer: 5′-GCAGAACCAATGCATTCAGTAGAGGTCCTG), and GFP primers (sense primer: 5′- AGGGGGAGGTGTGGGAGGTTTT, anti-sense primer: 5′- CCCAGCAGCGGTCACAAACT), respectively. The site-specific integration was confirmed with AAV D-sequence sense primer HAIJP1 (5′-AGGAACCCCTAGTGATGGAG) and a human chromosome 19 AAVS1 -specific anti-sense primer HAIJP2 (5′-TCAGAGGACATCACGTGGTG)[16].

FVIII-BDD expression analysis

Total RNA was extracted from recombinant FVIII-BDD cell line using Trizol Reagent (Sigma, USA) following the manufacturer's instructions. RNA (500ng) was reverse transcribed to cDNA with oligo (dT) primer according to the instruction of RevertAid First Strand cDNA Synthesis Kit (Thermo, USA). Real-time PCR assay was applied to determine the expression of FVIII-BDD with cDNA (1 μL cDNA diluted 1:10). Gene expression of FVIII-BDD was quantified using the SYBR Green PCR Master Mix kit (Tiangen, Beijing) and FVIII specific primers (sense primer: 5′ TGATGATGACAACTCTCCTT, anti-sense primer: 5′ TCTTCAGCAGCAATGTAATG) on the 7500 Real-Time PCR System (Applied Biosystems). Cycling was carried out for 2 min at 50°C, followed by denaturation at 95°C for 10 min. Amplification was carried out with 40 cycles of 95°C for 15 s and at 60°C for 1min. The specificity of each primer pair was confirmed by melting curve analysis. The GAPDH gene was used as an endogenous control (housekeeping gene). All reactions were carried out in triplicate, and the relative expression levels were calculated using the comparative CT method with the mean of the virgin cells used as reference[17].

The cloned cells were cultured on T-25 flask; the media was changed to serum-free media when they reached a confluence of above 90%. Following cultured in serum-free media for 48h, media were collected and the total proteins in media were concentrated by using Amicon® Ultra-4 Centrifugal Filter Devices (Millipore, USA) and resolved on 8% SDS-PAGE, and probed with Factor VIII (S2194) pAb (Bioword, USA). Unbound antibodies were washed from the blots with Tris-Tween buffered saline (TBST) solution and subsequently the membrane was incubated with an alkaline phosphatase-conjugated polyclonal goat anti-rabbit secondary antibodies (Abgent, USA) at 1: 5,000 dilution. After removing the secondary antibodies with wash buffer, blots were treated with chemiluminescent substrate (Millipore, USA). The blot was then exposed to X-ray film. Untransfected cells following the same experimental procedure were used as negative controls.

Procoagulant activity assay of FVIII-BDD

FVIII-BDD protein activity was measured by the chromogenic-based method using the Coamatic factor VIII (Chromogenix, Italy) according to the manufacturer's instructions. The cloned cells were cultured in 24-well plate; serum-free and phenol red free DMEM medium was used when they reached a confluence of about 80%. After cultured at 37°C for 72 hours, the conditioned media was collected to measure the procoagulant activity of FVIII-BDD. The standard curve 0-1 IU/mL was prepared using a recombinant coagulation factor VIII (Bayer, Germany), and HEK 293 cells were used as the control.